ID: 1008070832

View in Genome Browser
Species Human (GRCh38)
Location 6:47097271-47097293
Sequence GAACATGCAGGAAGGACGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008070825_1008070832 6 Left 1008070825 6:47097242-47097264 CCGTTGGACTGAGACAGTTAAAC No data
Right 1008070832 6:47097271-47097293 GAACATGCAGGAAGGACGGCGGG No data
1008070824_1008070832 7 Left 1008070824 6:47097241-47097263 CCCGTTGGACTGAGACAGTTAAA No data
Right 1008070832 6:47097271-47097293 GAACATGCAGGAAGGACGGCGGG No data
1008070823_1008070832 8 Left 1008070823 6:47097240-47097262 CCCCGTTGGACTGAGACAGTTAA No data
Right 1008070832 6:47097271-47097293 GAACATGCAGGAAGGACGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008070832 Original CRISPR GAACATGCAGGAAGGACGGC GGG Intergenic
No off target data available for this crispr