ID: 1008073771

View in Genome Browser
Species Human (GRCh38)
Location 6:47124655-47124677
Sequence TTGAAGAAGCAGAACCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008073771_1008073773 -3 Left 1008073771 6:47124655-47124677 CCAACCTGGTTCTGCTTCTTCAA No data
Right 1008073773 6:47124675-47124697 CAATATTGTGTTGATTATTCTGG No data
1008073771_1008073775 26 Left 1008073771 6:47124655-47124677 CCAACCTGGTTCTGCTTCTTCAA No data
Right 1008073775 6:47124704-47124726 TGCCTTTTCATTTAAACTTTAGG No data
1008073771_1008073774 -2 Left 1008073771 6:47124655-47124677 CCAACCTGGTTCTGCTTCTTCAA No data
Right 1008073774 6:47124676-47124698 AATATTGTGTTGATTATTCTGGG 0: 2
1: 15
2: 117
3: 358
4: 1162
1008073771_1008073776 27 Left 1008073771 6:47124655-47124677 CCAACCTGGTTCTGCTTCTTCAA No data
Right 1008073776 6:47124705-47124727 GCCTTTTCATTTAAACTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008073771 Original CRISPR TTGAAGAAGCAGAACCAGGT TGG (reversed) Intergenic
No off target data available for this crispr