ID: 1008077186

View in Genome Browser
Species Human (GRCh38)
Location 6:47157171-47157193
Sequence GTCTAAAGTTGGTGCTCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008077186_1008077192 11 Left 1008077186 6:47157171-47157193 CCATAAGAGCACCAACTTTAGAC No data
Right 1008077192 6:47157205-47157227 GAAGGCTGTGTGCCCACAAAAGG No data
1008077186_1008077193 20 Left 1008077186 6:47157171-47157193 CCATAAGAGCACCAACTTTAGAC No data
Right 1008077193 6:47157214-47157236 GTGCCCACAAAAGGAGTGTTTGG No data
1008077186_1008077189 -7 Left 1008077186 6:47157171-47157193 CCATAAGAGCACCAACTTTAGAC No data
Right 1008077189 6:47157187-47157209 TTTAGACAGCTGACCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008077186 Original CRISPR GTCTAAAGTTGGTGCTCTTA TGG (reversed) Intergenic
No off target data available for this crispr