ID: 1008077190

View in Genome Browser
Species Human (GRCh38)
Location 6:47157200-47157222
Sequence TGTGGGCACACAGCCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008077190_1008077196 26 Left 1008077190 6:47157200-47157222 CCCTGGAAGGCTGTGTGCCCACA No data
Right 1008077196 6:47157249-47157271 GCGTGAGCTAAATAGAGTGCAGG No data
1008077190_1008077193 -9 Left 1008077190 6:47157200-47157222 CCCTGGAAGGCTGTGTGCCCACA No data
Right 1008077193 6:47157214-47157236 GTGCCCACAAAAGGAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008077190 Original CRISPR TGTGGGCACACAGCCTTCCA GGG (reversed) Intergenic
No off target data available for this crispr