ID: 1008077191

View in Genome Browser
Species Human (GRCh38)
Location 6:47157201-47157223
Sequence TTGTGGGCACACAGCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008077191_1008077193 -10 Left 1008077191 6:47157201-47157223 CCTGGAAGGCTGTGTGCCCACAA No data
Right 1008077193 6:47157214-47157236 GTGCCCACAAAAGGAGTGTTTGG No data
1008077191_1008077196 25 Left 1008077191 6:47157201-47157223 CCTGGAAGGCTGTGTGCCCACAA No data
Right 1008077196 6:47157249-47157271 GCGTGAGCTAAATAGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008077191 Original CRISPR TTGTGGGCACACAGCCTTCC AGG (reversed) Intergenic
No off target data available for this crispr