ID: 1008077193

View in Genome Browser
Species Human (GRCh38)
Location 6:47157214-47157236
Sequence GTGCCCACAAAAGGAGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008077190_1008077193 -9 Left 1008077190 6:47157200-47157222 CCCTGGAAGGCTGTGTGCCCACA No data
Right 1008077193 6:47157214-47157236 GTGCCCACAAAAGGAGTGTTTGG No data
1008077186_1008077193 20 Left 1008077186 6:47157171-47157193 CCATAAGAGCACCAACTTTAGAC No data
Right 1008077193 6:47157214-47157236 GTGCCCACAAAAGGAGTGTTTGG No data
1008077187_1008077193 9 Left 1008077187 6:47157182-47157204 CCAACTTTAGACAGCTGACCCTG No data
Right 1008077193 6:47157214-47157236 GTGCCCACAAAAGGAGTGTTTGG No data
1008077191_1008077193 -10 Left 1008077191 6:47157201-47157223 CCTGGAAGGCTGTGTGCCCACAA No data
Right 1008077193 6:47157214-47157236 GTGCCCACAAAAGGAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008077193 Original CRISPR GTGCCCACAAAAGGAGTGTT TGG Intergenic
No off target data available for this crispr