ID: 1008077196

View in Genome Browser
Species Human (GRCh38)
Location 6:47157249-47157271
Sequence GCGTGAGCTAAATAGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008077194_1008077196 9 Left 1008077194 6:47157217-47157239 CCCACAAAAGGAGTGTTTGGTTC No data
Right 1008077196 6:47157249-47157271 GCGTGAGCTAAATAGAGTGCAGG No data
1008077195_1008077196 8 Left 1008077195 6:47157218-47157240 CCACAAAAGGAGTGTTTGGTTCA No data
Right 1008077196 6:47157249-47157271 GCGTGAGCTAAATAGAGTGCAGG No data
1008077191_1008077196 25 Left 1008077191 6:47157201-47157223 CCTGGAAGGCTGTGTGCCCACAA No data
Right 1008077196 6:47157249-47157271 GCGTGAGCTAAATAGAGTGCAGG No data
1008077190_1008077196 26 Left 1008077190 6:47157200-47157222 CCCTGGAAGGCTGTGTGCCCACA No data
Right 1008077196 6:47157249-47157271 GCGTGAGCTAAATAGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008077196 Original CRISPR GCGTGAGCTAAATAGAGTGC AGG Intergenic
No off target data available for this crispr