ID: 1008084601

View in Genome Browser
Species Human (GRCh38)
Location 6:47231031-47231053
Sequence GCTCTCATGGTCTTGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008084601_1008084605 -5 Left 1008084601 6:47231031-47231053 CCCTGCCTCAAGACCATGAGAGC No data
Right 1008084605 6:47231049-47231071 AGAGCCCTCTGAACTTATTCAGG No data
1008084601_1008084609 30 Left 1008084601 6:47231031-47231053 CCCTGCCTCAAGACCATGAGAGC No data
Right 1008084609 6:47231084-47231106 TCTACCCATTTCCTATAATAAGG No data
1008084601_1008084608 5 Left 1008084601 6:47231031-47231053 CCCTGCCTCAAGACCATGAGAGC No data
Right 1008084608 6:47231059-47231081 GAACTTATTCAGGAACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008084601 Original CRISPR GCTCTCATGGTCTTGAGGCA GGG (reversed) Intergenic