ID: 1008084602

View in Genome Browser
Species Human (GRCh38)
Location 6:47231032-47231054
Sequence GGCTCTCATGGTCTTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008084602_1008084608 4 Left 1008084602 6:47231032-47231054 CCTGCCTCAAGACCATGAGAGCC No data
Right 1008084608 6:47231059-47231081 GAACTTATTCAGGAACAATGAGG No data
1008084602_1008084609 29 Left 1008084602 6:47231032-47231054 CCTGCCTCAAGACCATGAGAGCC No data
Right 1008084609 6:47231084-47231106 TCTACCCATTTCCTATAATAAGG No data
1008084602_1008084605 -6 Left 1008084602 6:47231032-47231054 CCTGCCTCAAGACCATGAGAGCC No data
Right 1008084605 6:47231049-47231071 AGAGCCCTCTGAACTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008084602 Original CRISPR GGCTCTCATGGTCTTGAGGC AGG (reversed) Intergenic