ID: 1008084605

View in Genome Browser
Species Human (GRCh38)
Location 6:47231049-47231071
Sequence AGAGCCCTCTGAACTTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008084603_1008084605 -10 Left 1008084603 6:47231036-47231058 CCTCAAGACCATGAGAGCCCTCT No data
Right 1008084605 6:47231049-47231071 AGAGCCCTCTGAACTTATTCAGG No data
1008084602_1008084605 -6 Left 1008084602 6:47231032-47231054 CCTGCCTCAAGACCATGAGAGCC No data
Right 1008084605 6:47231049-47231071 AGAGCCCTCTGAACTTATTCAGG No data
1008084601_1008084605 -5 Left 1008084601 6:47231031-47231053 CCCTGCCTCAAGACCATGAGAGC No data
Right 1008084605 6:47231049-47231071 AGAGCCCTCTGAACTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008084605 Original CRISPR AGAGCCCTCTGAACTTATTC AGG Intergenic