ID: 1008084608

View in Genome Browser
Species Human (GRCh38)
Location 6:47231059-47231081
Sequence GAACTTATTCAGGAACAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008084603_1008084608 0 Left 1008084603 6:47231036-47231058 CCTCAAGACCATGAGAGCCCTCT No data
Right 1008084608 6:47231059-47231081 GAACTTATTCAGGAACAATGAGG No data
1008084604_1008084608 -8 Left 1008084604 6:47231044-47231066 CCATGAGAGCCCTCTGAACTTAT No data
Right 1008084608 6:47231059-47231081 GAACTTATTCAGGAACAATGAGG No data
1008084601_1008084608 5 Left 1008084601 6:47231031-47231053 CCCTGCCTCAAGACCATGAGAGC No data
Right 1008084608 6:47231059-47231081 GAACTTATTCAGGAACAATGAGG No data
1008084602_1008084608 4 Left 1008084602 6:47231032-47231054 CCTGCCTCAAGACCATGAGAGCC No data
Right 1008084608 6:47231059-47231081 GAACTTATTCAGGAACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008084608 Original CRISPR GAACTTATTCAGGAACAATG AGG Intergenic