ID: 1008084609

View in Genome Browser
Species Human (GRCh38)
Location 6:47231084-47231106
Sequence TCTACCCATTTCCTATAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008084607_1008084609 7 Left 1008084607 6:47231054-47231076 CCTCTGAACTTATTCAGGAACAA No data
Right 1008084609 6:47231084-47231106 TCTACCCATTTCCTATAATAAGG No data
1008084604_1008084609 17 Left 1008084604 6:47231044-47231066 CCATGAGAGCCCTCTGAACTTAT No data
Right 1008084609 6:47231084-47231106 TCTACCCATTTCCTATAATAAGG No data
1008084606_1008084609 8 Left 1008084606 6:47231053-47231075 CCCTCTGAACTTATTCAGGAACA No data
Right 1008084609 6:47231084-47231106 TCTACCCATTTCCTATAATAAGG No data
1008084602_1008084609 29 Left 1008084602 6:47231032-47231054 CCTGCCTCAAGACCATGAGAGCC No data
Right 1008084609 6:47231084-47231106 TCTACCCATTTCCTATAATAAGG No data
1008084603_1008084609 25 Left 1008084603 6:47231036-47231058 CCTCAAGACCATGAGAGCCCTCT No data
Right 1008084609 6:47231084-47231106 TCTACCCATTTCCTATAATAAGG No data
1008084601_1008084609 30 Left 1008084601 6:47231031-47231053 CCCTGCCTCAAGACCATGAGAGC No data
Right 1008084609 6:47231084-47231106 TCTACCCATTTCCTATAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008084609 Original CRISPR TCTACCCATTTCCTATAATA AGG Intergenic