ID: 1008084769

View in Genome Browser
Species Human (GRCh38)
Location 6:47232933-47232955
Sequence AAAGATAGGCTGCAAGTCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008084764_1008084769 17 Left 1008084764 6:47232893-47232915 CCCGCAGCTCCTCAGGATTTAGA 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1008084769 6:47232933-47232955 AAAGATAGGCTGCAAGTCACAGG 0: 1
1: 0
2: 0
3: 14
4: 166
1008084767_1008084769 8 Left 1008084767 6:47232902-47232924 CCTCAGGATTTAGAAAGTGGAGC 0: 1
1: 0
2: 1
3: 20
4: 163
Right 1008084769 6:47232933-47232955 AAAGATAGGCTGCAAGTCACAGG 0: 1
1: 0
2: 0
3: 14
4: 166
1008084765_1008084769 16 Left 1008084765 6:47232894-47232916 CCGCAGCTCCTCAGGATTTAGAA 0: 1
1: 0
2: 1
3: 11
4: 264
Right 1008084769 6:47232933-47232955 AAAGATAGGCTGCAAGTCACAGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008084769 Original CRISPR AAAGATAGGCTGCAAGTCAC AGG Exonic