ID: 1008086460

View in Genome Browser
Species Human (GRCh38)
Location 6:47250339-47250361
Sequence GGGAAGAATAGCTATGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008086453_1008086460 19 Left 1008086453 6:47250297-47250319 CCCACTGTTTTGCTGCTTATTCC 0: 1
1: 0
2: 0
3: 15
4: 216
Right 1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG 0: 1
1: 0
2: 0
3: 14
4: 128
1008086455_1008086460 -2 Left 1008086455 6:47250318-47250340 CCAAATGCTCATGTCCCAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 159
Right 1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG 0: 1
1: 0
2: 0
3: 14
4: 128
1008086454_1008086460 18 Left 1008086454 6:47250298-47250320 CCACTGTTTTGCTGCTTATTCCA 0: 1
1: 0
2: 0
3: 14
4: 260
Right 1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG 0: 1
1: 0
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008086460 Original CRISPR GGGAAGAATAGCTATGATTC TGG Intronic
902222922 1:14978203-14978225 TTGAAGAAAAGCTCTGATTCAGG - Intronic
902299505 1:15491909-15491931 GGGAAGCATGGCTAGGACTCAGG + Intronic
904794728 1:33050880-33050902 GGGAAACATAGCTTTTATTCTGG + Intronic
905992711 1:42353220-42353242 GGGAAGACTCTCTATGAGTCTGG - Intergenic
906891758 1:49724018-49724040 GGGTAGAATAGGAATGATTAGGG + Intronic
908603868 1:65772086-65772108 AGGAAGCACAGCTATGATTTGGG - Intergenic
909857164 1:80550219-80550241 TAGAAGAATAGTTATAATTCTGG + Intergenic
911521366 1:98934103-98934125 GAGAAGTTTAGCTATGCTTCTGG + Intronic
912120720 1:106468217-106468239 GGGTACTTTAGCTATGATTCTGG - Intergenic
913615676 1:120557830-120557852 CGGAAGAATAACGATGACTCTGG - Intergenic
914400316 1:147313745-147313767 AGGAAGAATAGATATCATGCTGG - Intergenic
914574600 1:148953072-148953094 CGGAAGAATAACGATGACTCTGG + Intronic
915781899 1:158561687-158561709 TGCTAGAATACCTATGATTCAGG + Intergenic
918023152 1:180714919-180714941 GGAAAGAATAGCTGATATTCTGG + Intronic
1064901924 10:20304273-20304295 GGTAAGAATAGCTAGGGTTCTGG + Intergenic
1071936929 10:90542287-90542309 GGGAAGAATATCTCTGCTCCAGG - Intergenic
1072301369 10:94065393-94065415 GAGAAGATTGGCCATGATTCTGG - Intronic
1072792750 10:98330284-98330306 GGGAAGTATAGCTATTTGTCAGG + Intergenic
1074094516 10:110298434-110298456 GAGAAGAATGGCTGGGATTCTGG - Intronic
1074209061 10:111311636-111311658 GGGAAGTATAGCAGTGCTTCTGG + Intergenic
1078646488 11:13145545-13145567 GGGCAGCATAGTTAAGATTCAGG - Intergenic
1084920137 11:72462569-72462591 TGGAAGAAGAACTAAGATTCTGG - Intergenic
1087371442 11:97290216-97290238 AGGAAGCTTAGCAATGATTCAGG - Intergenic
1087746408 11:101952662-101952684 GGGAAGAATAGATAGGTTTAGGG + Intronic
1088928868 11:114328942-114328964 GGGAAGAATATCTAAGAGGCAGG - Intergenic
1091484160 12:867908-867930 GGGAAAAATATCTGTGATTCTGG - Intronic
1092969612 12:13679832-13679854 GAGAAGAATAACTGAGATTCAGG - Intronic
1093457236 12:19377333-19377355 GGGAACAATTGCTATTATTCGGG + Intergenic
1095199397 12:39364827-39364849 GGGAAGAAGAGGTTTGTTTCAGG - Intronic
1097770572 12:63579627-63579649 GGGAAAAATAGCTATAACTGGGG + Intronic
1097803492 12:63940424-63940446 GAGCAGAATAGCTATGATCAAGG + Intronic
1099277436 12:80595056-80595078 AGAAAGAATAGCAAAGATTCTGG - Intronic
1099638671 12:85253425-85253447 GGGAAGTATAGCTCTGGTACTGG + Intronic
1099796301 12:87404778-87404800 TTTAAGAATAGCTATGATTAAGG + Intergenic
1100943998 12:99758329-99758351 GGGAAGGTTAGCTATAATTATGG + Intronic
1102091073 12:110188515-110188537 TGGAAGAAGAGTTAAGATTCTGG - Intronic
1104223645 12:126810503-126810525 GGTGAGAAGAGCTCTGATTCTGG + Intergenic
1106946470 13:34833190-34833212 GGGAGGAGTGGCTATGATACAGG + Intergenic
1111482875 13:88855117-88855139 TGGAAGAATGGCCCTGATTCAGG + Intergenic
1112798206 13:103080754-103080776 GGGAAGAAGAGCTATGAGAAAGG - Intergenic
1112851916 13:103716508-103716530 AGGAAGAATAGTGATTATTCAGG - Intergenic
1113752242 13:112784426-112784448 GGAAAGAAAAACTATGATACTGG - Intronic
1117303041 14:54447007-54447029 GGAAAGAATAGTTATGAAGCTGG + Intergenic
1118289559 14:64506732-64506754 GGGAAGAATAGAAAGGCTTCAGG - Intronic
1125248178 15:37666900-37666922 GGAAAGAAGTGCCATGATTCTGG + Intergenic
1125396316 15:39251970-39251992 TTGAATAATAACTATGATTCTGG - Exonic
1126714264 15:51497531-51497553 GTGAAAAATTGCTATGTTTCAGG - Intronic
1127830142 15:62743388-62743410 GGGAAGAAAAGGTTTGCTTCTGG + Intronic
1129271934 15:74423562-74423584 GGGTAGAGTAGGGATGATTCAGG - Intronic
1130155684 15:81348216-81348238 GGGAAGATTTGCTCTCATTCAGG - Intronic
1130682172 15:86006463-86006485 TGGAAGATTAGGTATGTTTCTGG + Intergenic
1131334743 15:91537540-91537562 GAGAATAATAGCTACGCTTCAGG - Intergenic
1131396751 15:92092345-92092367 GGGAAGAAGGGCTATGATTATGG + Intronic
1132837513 16:1961689-1961711 GGGAAGATTTGCAATGGTTCTGG - Intronic
1135242038 16:20816208-20816230 GGAAGGTATAGCTATGATGCTGG + Exonic
1140406246 16:74713500-74713522 GGGGAGAAGGGCTGTGATTCTGG + Exonic
1141200129 16:81891365-81891387 GGGAAGAACAGCTCTGATGCGGG - Intronic
1149801989 17:59577988-59578010 GTGAAAATTAACTATGATTCAGG + Intronic
1149844501 17:59997497-59997519 GTGAAAATTAACTATGATTCAGG - Intergenic
1159794320 18:72823295-72823317 GGGAAAATTAGCTAGGATTAAGG + Intronic
1159830028 18:73264841-73264863 GGGAACAATTGCTATGTTTTAGG + Intergenic
1161113113 19:2480650-2480672 GGGAAAAAAAACCATGATTCTGG - Intergenic
1162753752 19:12844743-12844765 GGGAGGAATAGAGATGATGCAGG + Intronic
1166579343 19:43879805-43879827 GTGAAGAATAGTGAAGATTCAGG + Intronic
924962649 2:47272-47294 CGTAAAAATAGCAATGATTCTGG - Intergenic
929432285 2:41897418-41897440 GGGTAGAAGGGCTGTGATTCAGG + Intergenic
930420005 2:51139604-51139626 GAGAAGAATAGGTATACTTCTGG + Intergenic
930718879 2:54619790-54619812 GGGAACAGTAGCTGTGATTCTGG + Intronic
932399174 2:71467693-71467715 AGGAACAATAGCTGTGAGTCAGG + Intronic
934054233 2:88238679-88238701 GGGAAGAATATTGATGAATCAGG - Intergenic
939228071 2:139388729-139388751 GGAAAGGAAAGCTATTATTCAGG + Intergenic
942246867 2:174016105-174016127 AGGAAGAATGGCTATAATGCAGG - Intergenic
944799076 2:203218888-203218910 GGAAAAAATAGCTATGTTTTAGG + Exonic
944870489 2:203906792-203906814 GGGGAAAATAGCTTTGATTGTGG + Intergenic
947284750 2:228501520-228501542 GGGTATAATAGATATGGTTCTGG + Intergenic
1179349786 21:40597597-40597619 GGGAAGAATAGCTAGAACCCAGG - Intronic
949322189 3:2823999-2824021 GGGAACCACAGCTATGACTCAGG - Intronic
951320640 3:21240363-21240385 GGGAAGATAAGCTATGATGAGGG - Intergenic
952119244 3:30221739-30221761 TGGAAGAATACTTATGATGCAGG - Intergenic
953745636 3:45571903-45571925 GGGGAGAATTGCTAAGTTTCTGG - Intronic
955678530 3:61475365-61475387 AGGAAGAAAAACTGTGATTCAGG - Intergenic
957174502 3:76788730-76788752 GAGAAGAATATCTATTATTGTGG + Intronic
957816990 3:85313410-85313432 GGGGAGAAAAGCAATGAGTCTGG - Intronic
959094421 3:101938130-101938152 GAGAACAACAGCTTTGATTCTGG + Intergenic
959450155 3:106488670-106488692 AGGAAGAATAGCAAGGATTCTGG - Intergenic
961837142 3:129671733-129671755 GGCAAGAATAGGTATGTTACTGG + Intronic
962975572 3:140442969-140442991 GGGATGAATGGCTTTGATTTGGG - Intronic
966207701 3:177421756-177421778 GTCAAGAAAAGCTATTATTCTGG - Intergenic
966746104 3:183278779-183278801 TGGAAAAATAACAATGATTCAGG + Intronic
969048840 4:4358244-4358266 GGGAAGAAGAGCAAGGATTCTGG + Intronic
970578111 4:17447453-17447475 GGGAAGGAAAGCAATGAATCTGG - Intergenic
972703733 4:41519503-41519525 AGGAAGAAAAGCTATGATCTTGG - Intronic
973156282 4:46957432-46957454 GGGAAGACTAGTTATGGTTAGGG + Intronic
973547858 4:52000152-52000174 GAGAAGAAATGGTATGATTCTGG + Intronic
974066200 4:57080004-57080026 GGGAAGCAGAGCCAGGATTCAGG + Intronic
974897992 4:67962452-67962474 AGGAATTATAGCCATGATTCTGG + Intronic
978633485 4:110776019-110776041 GGGAAGAATAGGAATTATTTTGG + Intergenic
982025453 4:151249901-151249923 GGGAAGAATAACTGAAATTCAGG - Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
985259814 4:188104836-188104858 AGAAAGAATGGCGATGATTCAGG - Exonic
986450710 5:7861481-7861503 GAAAAAAATAGATATGATTCTGG - Intronic
987571383 5:19665782-19665804 GGGAAGAATAGTTAATATTGTGG + Intronic
988728383 5:33946129-33946151 GGGAAGAAAACCTACGCTTCAGG - Intronic
989369984 5:40696137-40696159 GAGAGGACTAGCTATGATTTGGG - Intergenic
994805392 5:104440821-104440843 GAGAATGATACCTATGATTCTGG - Intergenic
998639773 5:143996291-143996313 AGGAAGTATAGCTATGAAACAGG - Intergenic
999073053 5:148768085-148768107 GGGAAGAATTTCTATGACTTGGG - Intergenic
1000655106 5:163868212-163868234 GGGTATAAAATCTATGATTCTGG - Intergenic
1001977596 5:176012975-176012997 GGGCAGACTAGCTGTGATTCAGG + Intronic
1002239825 5:177830791-177830813 GGGCAGACTAGCTGTGATTCAGG - Intergenic
1002347445 5:178557755-178557777 GGGAAGAATAGGAATGAGTTAGG + Intronic
1004791331 6:19029592-19029614 GGGAAGAGATGCTATGATTCAGG + Intergenic
1004829173 6:19458776-19458798 GGAAAGAATTGCAATCATTCTGG + Intergenic
1005671404 6:28109609-28109631 TTGAAGAATAGCTATGAATTGGG - Intergenic
1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG + Intronic
1008441576 6:51538050-51538072 GGGAAATATAGCAATGATTATGG - Intergenic
1011465074 6:87646991-87647013 GGCAAGAAGAGGTCTGATTCTGG - Intronic
1015236941 6:130981695-130981717 GGGAAAAATAGCTCTGCTTCTGG - Intronic
1018992252 6:168683088-168683110 GGAAGGAAAAGCTCTGATTCTGG - Intergenic
1021364999 7:19767295-19767317 GGGAAATATAGTTATTATTCAGG - Intronic
1022291880 7:29012985-29013007 GGGAAGAATGGCAAAGAATCTGG - Intronic
1022930050 7:35101884-35101906 GGGAAAAATAGCTATAACTGGGG + Intergenic
1025023419 7:55497370-55497392 GGGAAGAAGAGCTCTGCTTCTGG - Intronic
1030437760 7:109546607-109546629 GAGAAGAATAACTGTTATTCAGG - Intergenic
1031154457 7:118093558-118093580 GGGAAGTATAACTTTGATTCTGG - Intergenic
1032663454 7:134011553-134011575 GGAAACAAAAGCTACGATTCGGG + Intronic
1037007695 8:13802986-13803008 GGCAAGAAAAGCTATTATTGAGG + Intergenic
1041550619 8:59096753-59096775 GGGAAGCATAGCTAAGAACCAGG + Intronic
1048355894 8:133653854-133653876 GGGATGGATAGGTATGATTTTGG + Intergenic
1049206105 8:141364289-141364311 GGCTAAAATAGCCATGATTCGGG + Intronic
1051975032 9:22938924-22938946 GGGAAGATTAACTAAGAGTCTGG - Intergenic
1057814793 9:98286587-98286609 AGGAAGACCAGCTAAGATTCTGG + Intergenic
1057979076 9:99639995-99640017 GGAATGAATAGCTATTATTATGG + Intergenic
1057988009 9:99737428-99737450 GGGAAGAAGTGGTAAGATTCTGG - Intergenic
1059360047 9:113735106-113735128 GGGGAGTATAGCTTTTATTCTGG + Intergenic
1060925000 9:127450145-127450167 AGGAAGAATAGTTAAGATACAGG + Intronic
1186046426 X:5541635-5541657 GGGATGAATAACTGTGATTTAGG + Intergenic
1188642138 X:32519540-32519562 GGGAAGAATAATTATCTTTCTGG + Intronic
1190259922 X:48791191-48791213 GGGAAGAAAACCCCTGATTCTGG - Exonic
1194773413 X:97932675-97932697 GAAAATAATAGCTATGTTTCAGG + Intergenic
1195960624 X:110382753-110382775 GGGGAGAAGGGCTTTGATTCAGG - Intronic
1198502766 X:137268538-137268560 AGGAAGAATAGCTCTAACTCTGG + Intergenic
1199222499 X:145333796-145333818 GGGAAGAATTGTTATCATTTTGG + Intergenic