ID: 1008086595

View in Genome Browser
Species Human (GRCh38)
Location 6:47251811-47251833
Sequence AAAACTAGGCTTTAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008086595 Original CRISPR AAAACTAGGCTTTAAGTAGC TGG (reversed) Intronic
902521932 1:17023550-17023572 AAATCCAGGCTTTCATTAGCTGG + Intronic
907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG + Intergenic
908676130 1:66606088-66606110 AAAAATAGGCATTATGTAGTAGG + Intronic
909328907 1:74388861-74388883 CAAATTAGGCAATAAGTAGCTGG + Intronic
909399170 1:75207248-75207270 AAAACTAGGTGTCAAGAAGCTGG - Intronic
909764555 1:79339271-79339293 AAAACAAGTATTTGAGTAGCAGG + Intergenic
912778440 1:112522190-112522212 AAAACTATGTTTAAATTAGCTGG - Exonic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
916687399 1:167159593-167159615 AAAAAAAGACTTTAATTAGCTGG + Intergenic
919417005 1:197323380-197323402 AAAACATGGCTTTATGGAGCGGG + Intronic
919485304 1:198138839-198138861 ATAAGTAGGCTGTAAGTATCTGG + Intergenic
1070001188 10:72378705-72378727 AAAACAAGGCTTGGAGTAACGGG + Intronic
1070802660 10:79252551-79252573 AAAGCAAGGCTTCAGGTAGCAGG - Intronic
1073317279 10:102592015-102592037 AACACTAGGCTTCAAGTAAATGG - Intronic
1074874262 10:117602160-117602182 GAAGCAAGGCTTTAAGTAGATGG + Intergenic
1075721344 10:124589414-124589436 AAAACTTGGCTTTAAAAAGCTGG + Intronic
1075722830 10:124597506-124597528 GACACTAGGCTCTAAGTAGTGGG + Intronic
1075728258 10:124621569-124621591 AAAAATCAGCTTTAAGGAGCTGG - Exonic
1078403264 11:11045980-11046002 AATACTATGCTTTCTGTAGCTGG + Intergenic
1079850047 11:25521251-25521273 AAAAGTTGGCTTTAAGGAGAGGG + Intergenic
1096339618 12:50786588-50786610 AAAAAAAGGCTTTAAGCCGCTGG + Intronic
1097405904 12:59189764-59189786 AAAAATAAGCTTTATTTAGCTGG - Intergenic
1098581897 12:72109854-72109876 AAAATTGGGCTTTACTTAGCAGG + Intronic
1098855320 12:75646270-75646292 AAGCCTTGGCTTTAAGTATCAGG + Intergenic
1099896518 12:88654554-88654576 AAACCTAGGGTTTATATAGCAGG - Intergenic
1100620590 12:96268666-96268688 CAAACTGGGCATTAAGTGGCAGG + Exonic
1102328469 12:112010223-112010245 GAAACAAGGCTTTATGTAACTGG - Intronic
1102841361 12:116127813-116127835 AAAATAAGGCTTTAAGAGGCAGG - Intronic
1107777376 13:43860598-43860620 AAAACTAGGCTTTAAAAAGAAGG - Intronic
1108527817 13:51300729-51300751 AAAACAATGCTTTAAGTAAAAGG + Intergenic
1108751274 13:53450616-53450638 AAAATTAGGGTTTAAATAGCAGG - Intergenic
1108908377 13:55508814-55508836 AAAACTAGGCTTTATATAACCGG + Intergenic
1109522149 13:63527615-63527637 AAAACTAGGGCTTTAGTGGCAGG + Intergenic
1110300334 13:73919130-73919152 AAAAATAATCTTTAAGTATCTGG - Intronic
1110322857 13:74179640-74179662 AAAACTAGAATTTAACAAGCTGG - Intergenic
1110970813 13:81758660-81758682 AAAAATAGGCTTCAAGTGTCAGG - Intergenic
1111924797 13:94451192-94451214 AATACTAGTTTTTAAATAGCAGG - Intronic
1115923547 14:38405767-38405789 AAAGCTAGACTATAATTAGCTGG + Intergenic
1116266422 14:42697050-42697072 AAAAATAGGTCTTATGTAGCTGG + Intergenic
1118390078 14:65288311-65288333 AAAAGTAGGCTTTATGTATGGGG - Intergenic
1118409374 14:65461833-65461855 AAAACCAGGGTTTATATAGCAGG + Intronic
1120239210 14:81930211-81930233 AAATGTAGGGTTTAACTAGCAGG - Intergenic
1121225488 14:92318882-92318904 AAGACTAGGCTTAGAGAAGCTGG + Intergenic
1121874062 14:97434865-97434887 AAAACCAGGCTTTTAGCAGAAGG + Intergenic
1125648479 15:41293380-41293402 AAAACTAGATTTTCAGCAGCTGG + Intergenic
1126164195 15:45640152-45640174 ATAACAAGGCTTTAATAAGCAGG - Intronic
1126936590 15:53716136-53716158 AAATCTTGGCTTTTAGTAGATGG - Intronic
1128544918 15:68560454-68560476 AAAAATTGTCTTTAATTAGCTGG - Intergenic
1128782763 15:70373873-70373895 AAAATTATGCTTTAAGTACTAGG - Intergenic
1141288245 16:82692773-82692795 AAACCTAGGTTCTCAGTAGCTGG + Intronic
1146128071 17:30244796-30244818 AAAACTAGGATTAAACTGGCCGG - Intergenic
1149750432 17:59140577-59140599 AAAACTAGCCTTTTAGAGGCAGG - Intronic
1155870276 18:31019016-31019038 GAAATTATGCTTTAAGTAACAGG + Intronic
1156063139 18:33105701-33105723 CAAACTAGGATTTAAGGAACTGG - Intronic
1157691747 18:49688387-49688409 AAAAGTAGGCTTTAAGAAGTGGG + Intergenic
1163051367 19:14686687-14686709 AATGCTGGGCTTTAAGAAGCTGG + Intronic
1165662080 19:37590106-37590128 AAAAAAAGGCTATAAGGAGCTGG + Intronic
1166459245 19:42971657-42971679 AAAACGAGGCTTGAACTTGCTGG + Intronic
932130165 2:69180268-69180290 AAAACAAGGCTGTGAGAAGCAGG + Intronic
933037636 2:77420409-77420431 TACACTAGGGTTTAATTAGCAGG + Intronic
933121153 2:78540139-78540161 AAAAAAAAGCTCTAAGTAGCAGG + Intergenic
935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG + Intergenic
936966213 2:118129790-118129812 AGAACCAGGCTTTAAGGAGAAGG - Intergenic
937408138 2:121649360-121649382 AAAACAGGGCTGTAAGTACCCGG - Exonic
940484312 2:154277167-154277189 AAAACTAAGATTTAAATGGCAGG + Intronic
941470959 2:165886202-165886224 AAAAATAGGATTTAAGAAACAGG - Intronic
942971169 2:181959956-181959978 AAAATTAGGCTTTTATTAGATGG + Intronic
944964844 2:204919049-204919071 AAATCTAGGTGTTAAGTAGATGG - Intronic
1170433960 20:16304910-16304932 AAAACTAGGCTGTGTGTTGCAGG + Intronic
1170931394 20:20772206-20772228 AAAATTGAGGTTTAAGTAGCTGG + Intergenic
1171156853 20:22882393-22882415 AAAAATCTGCTTTAAATAGCTGG - Intergenic
1171774885 20:29355831-29355853 AAAACTAGGCTTTAGGAGGTGGG + Intergenic
1173274811 20:41570768-41570790 ACAACTGAGCTTTAAGCAGCTGG + Intronic
1173447436 20:43132274-43132296 AAAACTAAGATTTCAGTAGGTGG + Intronic
1176418070 21:6491115-6491137 AAAACTGGGCATTCAGTAGATGG - Intergenic
1177189759 21:17837898-17837920 AAAACTAGTCTTTAAATTGTTGG - Intergenic
1179693564 21:43099445-43099467 AAAACTGGGCATTCAGTAGATGG - Intronic
1179802659 21:43818364-43818386 AAAAAAAGGTTTTAATTAGCTGG - Intergenic
1184023186 22:41834179-41834201 AGAACTAGGCTCTAACCAGCTGG - Intronic
952099288 3:29992886-29992908 AAAACTAGGCTATAAAGAACTGG + Intronic
954183153 3:48897582-48897604 AAGACCAGGGTTAAAGTAGCTGG - Intronic
957205588 3:77194284-77194306 ACAACTAGGCATTAATTAGCAGG - Intronic
957567071 3:81897616-81897638 AAAATTAAGCTTTAATTATCAGG + Intergenic
959772327 3:110113573-110113595 AAAACTTGGCTTTAAATCTCTGG - Intergenic
960620494 3:119632308-119632330 GAAACATGGCTTTAAGTAGATGG + Intergenic
962958661 3:140290029-140290051 AAAACTAGACTTTATGTAAAAGG + Intronic
964132654 3:153307949-153307971 AAAAATAGGATTAAAGTAGTAGG - Intergenic
965560657 3:170059421-170059443 AAAATTAGGCTTTATTTACCTGG + Intronic
966517169 3:180830458-180830480 AAATCTAGTCATTAAGAAGCGGG + Intronic
966769978 3:183495064-183495086 AAATCTTTGCTTTAAGTAGTTGG - Intronic
967590774 3:191271341-191271363 AAAACTAGGGTTAATATAGCAGG - Intronic
968278619 3:197459210-197459232 AAAACTAGGCTTGCAGAAGCAGG + Intergenic
970647324 4:18137410-18137432 AATACTAAGTTTTAAGGAGCAGG + Intergenic
971048513 4:22832425-22832447 AAAACTATGCTTCAAGTCCCAGG + Intergenic
972982275 4:44720420-44720442 AAGAATAGGCTTGAAGTTGCTGG - Intronic
977611180 4:99033395-99033417 AAAATAAGACTTTAAGTAGCCGG - Intronic
980716027 4:136631111-136631133 ATAACTAGTCTTCAAGTAACAGG + Intergenic
982325673 4:154126242-154126264 AAACCTAAGCTTTGAGCAGCAGG + Intergenic
982337189 4:154253268-154253290 AACTCTAGGCTTGAAGAAGCAGG - Intronic
989996769 5:50843562-50843584 AAAAATAGGCTTGAAGTGGTTGG + Exonic
990387264 5:55278043-55278065 AAAAAGAGGCATTAACTAGCAGG + Intronic
993135193 5:83952066-83952088 TAACTTTGGCTTTAAGTAGCTGG + Intronic
995870553 5:116739295-116739317 AAAACCAGGCTCTGAGTGGCTGG - Intergenic
996606245 5:125327026-125327048 AAAACTTTGCTATAATTAGCAGG - Intergenic
997900814 5:137762688-137762710 AAATCTAGGCTTTTAGAAGAGGG + Intergenic
999526074 5:152407196-152407218 AAAACTTGCCTTTAACTAGAGGG - Intronic
1006484327 6:34326140-34326162 AAAAGCAGGCTTTATGTAGATGG - Intronic
1007734201 6:43970556-43970578 AAGTCTAGGCTGGAAGTAGCAGG - Intergenic
1008086595 6:47251811-47251833 AAAACTAGGCTTTAAGTAGCTGG - Intronic
1010014252 6:71086140-71086162 AAAACTATTCTTTAGGTAGATGG + Intergenic
1011594120 6:88999638-88999660 AAAGCTAGGTTTTAAATTGCTGG + Intergenic
1011670383 6:89677763-89677785 AAGACTTTGCTTTGAGTAGCAGG - Intronic
1012035271 6:94129316-94129338 AAAACTAGGCTTAAAGAAATAGG - Intergenic
1013557559 6:111272027-111272049 AAAAATAACTTTTAAGTAGCAGG - Intergenic
1013591977 6:111626630-111626652 AAAGCTGTGCTTTAATTAGCCGG - Intergenic
1014903952 6:127003624-127003646 ATTACTTGGCTTTTAGTAGCAGG + Intergenic
1015613677 6:135052762-135052784 AAATCCATACTTTAAGTAGCTGG - Intronic
1016240536 6:141924218-141924240 AAAACCAGGCATTAAGTTGAAGG - Intergenic
1018006647 6:159628463-159628485 AAAACCTGGCTTTGAGTAGAAGG - Intergenic
1018292037 6:162301677-162301699 TAAACTAGGCTGTAAGTATTGGG - Intronic
1018566207 6:165156490-165156512 AAAACTAGGCTTAGGATAGCTGG - Intergenic
1020696463 7:11419990-11420012 TAAGCTAGGCTTTTAGAAGCAGG - Intronic
1021185926 7:17564806-17564828 AAAACTAGGTTTCAAGTGGATGG - Intergenic
1022199245 7:28100010-28100032 AAAACTTGACTTTAAGTACTTGG - Intronic
1022725749 7:32980077-32980099 AAATCAAGGCTTTATGTAGGTGG - Intronic
1026388168 7:69872733-69872755 AAAACTACTATTAAAGTAGCAGG + Intronic
1026882239 7:73914773-73914795 AAGACTAGGGTTCAAGAAGCAGG - Intergenic
1027612805 7:80383422-80383444 ACACCTAGGCTTTATGTAGTAGG - Intronic
1031452434 7:121938338-121938360 ATAACTTGTCTTTAAGTAGAAGG + Intronic
1031867667 7:127056309-127056331 AAAACTAACCTTAAAGAAGCAGG + Intronic
1033991658 7:147295126-147295148 AAAATGAGGCTTTGAGTAGGTGG - Intronic
1041979418 8:63839364-63839386 AAAACTAGGCTTTCAATTTCAGG - Intergenic
1043645382 8:82510826-82510848 AAGATGAGGCTTTAAGTAGATGG - Intergenic
1043841896 8:85116094-85116116 AAAACTAGAGATTCAGTAGCAGG - Intronic
1044685530 8:94822811-94822833 TCAACTAGGCTCTAAGTATCGGG + Intronic
1045325826 8:101117003-101117025 ATAACTAGCCTTTAAGGAGGGGG - Intergenic
1045904825 8:107332335-107332357 AAAACCAGGTTTTAAGTTTCGGG + Intronic
1049025684 8:139987258-139987280 ATAACTAGGGTTGAAATAGCTGG + Intronic
1049034082 8:140060942-140060964 AAAACAAGGCTTTAAGAATGAGG + Intronic
1049987617 9:966641-966663 AGAGCTAGGATTTAAGAAGCAGG - Intronic
1057443112 9:95096269-95096291 AAACCTAGGCAGTGAGTAGCGGG + Intergenic
1057808416 9:98238247-98238269 AAAAAAAGGGCTTAAGTAGCTGG - Intronic
1058008500 9:99946455-99946477 AAAAGTAGCATTTAAGTTGCAGG - Intronic
1059807236 9:117815595-117815617 TAAAATATGCTTTAAGTGGCGGG - Intergenic
1062090498 9:134675864-134675886 AAGTCTAGGCTTTAAGAAACTGG - Intronic
1203490964 Un_GL000224v1:104052-104074 AAAATTTGGCTTTGAGGAGCTGG + Intergenic
1203503588 Un_KI270741v1:45925-45947 AAAATTTGGCTTTGAGGAGCTGG + Intergenic
1185553124 X:999583-999605 AAAAGAATGCTTTAAGAAGCGGG + Intergenic
1189151894 X:38717848-38717870 TAAACTAGGCTTTCAGGAGTGGG + Intergenic
1197650437 X:129058039-129058061 AGAAATAGGCTTTAGTTAGCAGG - Intergenic
1197893331 X:131286777-131286799 TAAACTAAACTTTAAGGAGCAGG - Intronic
1198978121 X:142360595-142360617 AACACTAGACTATAAGTAGTGGG - Intergenic
1199168584 X:144707870-144707892 AACAGTAGGCTATGAGTAGCTGG + Intergenic