ID: 1008087739

View in Genome Browser
Species Human (GRCh38)
Location 6:47262102-47262124
Sequence CCGTAAGCTCAGATGAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008087739 Original CRISPR CCGTAAGCTCAGATGAACCT TGG Intronic
905118200 1:35660588-35660610 CTGTAAGTCCAGATGGACCTTGG - Intergenic
907181895 1:52578117-52578139 CTGTAGTCTCAGCTGAACCTGGG + Intergenic
1072983238 10:100117254-100117276 CCCTAAGGTGAGATGAGCCTGGG - Intergenic
1073253835 10:102138508-102138530 CCATTAGCTGAGTTGAACCTGGG + Intronic
1076205581 10:128598437-128598459 CCGTATGCTGAGCTTAACCTGGG + Intergenic
1077313810 11:1906737-1906759 CCGGGAGCTCACATGGACCTAGG - Intergenic
1085290119 11:75392169-75392191 CTGAAAGCTCAGATGATCATTGG + Intergenic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1105359806 13:19699246-19699268 CCAAAAGCTGAGATGAGCCTGGG - Intronic
1106442228 13:29786138-29786160 CTGTGGGCTCAGATGCACCTGGG - Intronic
1106668227 13:31875709-31875731 CTGTAAGCTAACATGAGCCTAGG - Intergenic
1121910526 14:97787166-97787188 CTGAAGGCTCAGATGATCCTTGG + Intergenic
1130331335 15:82924650-82924672 CCGCAATCTCAGCAGAACCTTGG + Intronic
1135183196 16:20292487-20292509 CCCTAAGGTCAGATGGACCTGGG + Intergenic
1137821230 16:51447988-51448010 CTTTAAGGTCAAATGAACCTGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1151260694 17:72913661-72913683 CCGCAACCTCAGAGGAGCCTTGG - Intronic
1152568777 17:81112169-81112191 CCCTCAGCTCAGAGGGACCTGGG - Intronic
1156208111 18:34907785-34907807 CCATAACCTGAGAAGAACCTGGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1159599771 18:70417821-70417843 CCGTAATCTCAGAGGAAGGTGGG - Intergenic
1160090887 18:75825677-75825699 CTGGAAGGTCAGATGCACCTAGG - Intergenic
1163587384 19:18171495-18171517 TAGGAAGATCAGATGAACCTGGG + Intronic
1168296789 19:55380958-55380980 GCGTAAGCTAACATGAAGCTTGG - Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
931058171 2:58495984-58496006 CCTTAAGCTCAGATAAATCTTGG - Intergenic
939334030 2:140802028-140802050 CCTTAAGCTCAGAGGGAACTGGG - Intronic
941430027 2:165402890-165402912 CTGGAAGCTCATCTGAACCTTGG + Intergenic
946736782 2:222761777-222761799 CAGAAAGATCAGTTGAACCTGGG + Intergenic
1169426174 20:5498948-5498970 CAGTGAGCTGAGATGAACCCAGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1184255758 22:43285893-43285915 CCTTGTGCACAGATGAACCTGGG + Intronic
950989007 3:17411180-17411202 CTGAAGGCTCAGATGATCCTTGG + Intronic
951835624 3:26980273-26980295 CCTTAATCTCAGATAAACATGGG + Intergenic
955097949 3:55818543-55818565 CCTTCTGCTCAGATGAATCTAGG + Intronic
955575079 3:60352592-60352614 CCGGAGGATCACATGAACCTAGG - Intronic
960636309 3:119788324-119788346 CAGGAATTTCAGATGAACCTGGG - Intronic
961472305 3:127123508-127123530 CCGTAATCTCAGCTGATTCTGGG - Intergenic
966051755 3:175625683-175625705 CCGTAGCCTCAAATAAACCTGGG + Intronic
968446220 4:653665-653687 CCACAAGCTCAGATGAAACCTGG + Intronic
969577072 4:8042430-8042452 CCGTCTGCTCAGATGCTCCTTGG - Intronic
970501027 4:16677277-16677299 AGGTAAGCTCAGAAGACCCTTGG - Intronic
979207619 4:118059170-118059192 CAGTAAGCTCAGATGTGACTGGG - Intronic
979886965 4:126040369-126040391 CAGGAAGCTCACTTGAACCTTGG + Intergenic
985873220 5:2575456-2575478 TTGTAAGCTCAGGTGAAGCTGGG - Intergenic
1003441349 6:6145591-6145613 CAGGAAGCTGAGATGAACCCTGG - Exonic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006410154 6:33868832-33868854 CTGGCAGCTCAGAAGAACCTGGG - Intergenic
1008087739 6:47262102-47262124 CCGTAAGCTCAGATGAACCTTGG + Intronic
1019261927 7:86597-86619 CCTTGAGCTAAGATGAACTTAGG - Intergenic
1026881718 7:73910312-73910334 TCTTAAGGTCAGAAGAACCTCGG - Intergenic
1031974616 7:128085855-128085877 TGGTAAGCTCAGAGGGACCTTGG - Intronic
1048577399 8:135703961-135703983 ACGGAAGCTCAGATGCACCAGGG + Intergenic
1050339828 9:4625379-4625401 CAGCCAGCTCAGTTGAACCTTGG - Exonic
1053051093 9:34960932-34960954 GGGTAAGCTCAAATGAAACTGGG - Intronic
1058039210 9:100285730-100285752 AAGAAAGCTCACATGAACCTAGG + Intronic
1059084117 9:111281714-111281736 CAGTAGGCTCACTTGAACCTGGG - Intergenic
1190218874 X:48498062-48498084 CCGGGAGCTCAGATGCGCCTGGG - Intergenic
1190914869 X:54803885-54803907 CCATAAACTCTGAAGAACCTAGG - Intergenic
1193902060 X:87192582-87192604 CTGTCAGCTCAGATGAGCCAAGG + Intergenic
1196716635 X:118817997-118818019 CAGGAAGATCACATGAACCTGGG - Intergenic
1197377991 X:125705652-125705674 CTGTCAGCTCAAATGTACCTGGG + Intergenic