ID: 1008090184

View in Genome Browser
Species Human (GRCh38)
Location 6:47285946-47285968
Sequence TTGGGAACATAAGTGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008090176_1008090184 15 Left 1008090176 6:47285908-47285930 CCTTCCTCAAATAAATAATTCAT 0: 1
1: 0
2: 1
3: 58
4: 609
Right 1008090184 6:47285946-47285968 TTGGGAACATAAGTGGAGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 233
1008090175_1008090184 30 Left 1008090175 6:47285893-47285915 CCACTGGGCTCAAAGCCTTCCTC 0: 1
1: 0
2: 7
3: 49
4: 413
Right 1008090184 6:47285946-47285968 TTGGGAACATAAGTGGAGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 233
1008090177_1008090184 11 Left 1008090177 6:47285912-47285934 CCTCAAATAAATAATTCATGAGG 0: 1
1: 0
2: 3
3: 83
4: 595
Right 1008090184 6:47285946-47285968 TTGGGAACATAAGTGGAGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008090184 Original CRISPR TTGGGAACATAAGTGGAGGA AGG Exonic
900331449 1:2136692-2136714 TTGGGAATATCTGTGGAGTATGG + Intronic
902418273 1:16255935-16255957 TTGGGATAATAAGTAGAGGATGG + Intronic
903249642 1:22043451-22043473 ATGTGGGCATAAGTGGAGGAGGG + Intergenic
903547938 1:24138494-24138516 ATGGGAACATATGGAGAGGAGGG + Intronic
905585646 1:39115468-39115490 TAGAGAATATAAGAGGAGGAAGG + Intronic
907473075 1:54686856-54686878 TTGGGAACATAACTGGGGTAAGG - Intronic
907477797 1:54717720-54717742 TTGAGAACATCAGAGGATGAGGG + Intronic
907481653 1:54749054-54749076 TAGGGAACACAAGAGGAGGAAGG - Intergenic
909427088 1:75537685-75537707 TTGGGAATACAAGGTGAGGAGGG + Intronic
912680066 1:111723390-111723412 TTGGGAAGAGAAAGGGAGGAGGG + Exonic
917509415 1:175657996-175658018 CTGGGAACCCAAGTGGAGGTAGG - Intronic
918294947 1:183147736-183147758 ATGGGAGCATAGGTGGAGAAAGG - Intergenic
918676169 1:187288829-187288851 TTGGGAATAAAAGTGGAGAGTGG - Intergenic
918843302 1:189573377-189573399 TTAGGGACAGAGGTGGAGGAAGG + Intergenic
920100283 1:203513108-203513130 TGGGGAACAGAAATGGAGAAAGG + Intergenic
920572813 1:207030790-207030812 TTGGGAACTTAACGGGAGGAGGG + Intronic
921278302 1:213541044-213541066 TTCGAAACTTCAGTGGAGGAAGG - Intergenic
922801863 1:228368153-228368175 TTGTGAACCTCAGTGGGGGAGGG - Intronic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
923577225 1:235170440-235170462 TTAAAAACATAAGTGGAGGCCGG + Intronic
923749476 1:236734307-236734329 TTAGGAACATAAGTGTATGGGGG + Intronic
1066119206 10:32267462-32267484 TTTGGAAGAAAAGTGAAGGAAGG - Intergenic
1068898597 10:62237699-62237721 TTAGGTACAAAAGTGGGGGAGGG - Intronic
1070371869 10:75790236-75790258 TTGTGATCATAACTTGAGGAAGG - Intronic
1072768526 10:98116407-98116429 TTGGGAAGGCAAGTGGAGGGAGG + Intergenic
1073977543 10:109118070-109118092 TGGGGAACAGAAGAGGGGGATGG - Intergenic
1076558563 10:131346115-131346137 TTTGGAACCTGAGTAGAGGAGGG - Intergenic
1077409956 11:2399336-2399358 TTGGGAGCAGCAGGGGAGGAGGG - Intergenic
1077621981 11:3733615-3733637 TTGAAAACATAAGTGAAGGCCGG - Intronic
1078692235 11:13593831-13593853 TTGGGAGCATAAGGTGAGAAGGG + Intergenic
1079509636 11:21196111-21196133 TTTGCTACATAAGTGGAGGTTGG + Intronic
1081303191 11:41478526-41478548 TTGGGTACATATGTGGTGGTGGG - Intergenic
1081567740 11:44270277-44270299 TTTGGAACAGGAGTGGAAGAAGG + Intronic
1084230630 11:67750128-67750150 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
1086515872 11:87612804-87612826 TTCCAAAAATAAGTGGAGGAGGG - Intergenic
1087853124 11:103056534-103056556 TGGGGAAAGTAAGTTGAGGAAGG - Intergenic
1088202227 11:107350824-107350846 TTGAGAAGATATGTGAAGGAAGG + Intronic
1088651984 11:111966016-111966038 GGGGGAACATAAGTGGAAAAAGG - Intronic
1088720037 11:112584321-112584343 TTTGGATCATAAGTGGAGAATGG + Intergenic
1091193283 11:133711924-133711946 TAGGGAACAGAAGTGGTGGTGGG - Intergenic
1092225417 12:6745206-6745228 TTGGGAACATAAAGGCAGGAAGG + Intergenic
1092511609 12:9162755-9162777 TTGGGAAAAAAAGAGTAGGATGG - Intronic
1092756752 12:11770593-11770615 ATTGGAAGATAAGTAGAGGAAGG - Intronic
1092793843 12:12091770-12091792 TTGGGACCACAAGTAGAGGGTGG + Intronic
1093450842 12:19311721-19311743 TTTAGAACTTCAGTGGAGGAAGG - Intronic
1096175992 12:49519562-49519584 TGGGGAACATACATGGAGGGTGG - Intronic
1096367004 12:51036490-51036512 TGGGGCACATGTGTGGAGGATGG + Intergenic
1100129717 12:91476517-91476539 TTGGAAAAAAAAGTGGAGAAAGG - Intergenic
1100137548 12:91572177-91572199 TGGGGAATTCAAGTGGAGGAAGG + Intergenic
1100485058 12:95017540-95017562 TTGAGAACAGAAGTTGAGAAAGG - Intergenic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102416886 12:112771077-112771099 TAGGGAACAGATGTGGGGGAAGG - Intronic
1102454118 12:113061020-113061042 TCGGGAACATAAGGGGATGCTGG - Intronic
1104145285 12:126027597-126027619 TTGGGAGCAAAAGAGGATGATGG + Intergenic
1106628932 13:31450282-31450304 TTGGGAACATTTGTGAAGTAAGG - Intergenic
1107515847 13:41128602-41128624 TAAAGAACATAAGTGGATGATGG - Exonic
1108705175 13:52978974-52978996 TTGGGAACAGGAGTGGCTGAGGG - Intergenic
1111241571 13:85481843-85481865 ATGGAAACTTAAGTGGAGAAGGG - Intergenic
1111814502 13:93133696-93133718 GTGGGAGCAAGAGTGGAGGAAGG - Intergenic
1112267425 13:97937669-97937691 TGTGGAACATTACTGGAGGAGGG - Intergenic
1112495257 13:99898993-99899015 ATCAGAACCTAAGTGGAGGAGGG - Intergenic
1119126751 14:72134514-72134536 TTGGGCACAAAAATGGAGGCAGG + Intronic
1121898386 14:97670280-97670302 TTGGCAAGAGAAGTGGAGGAGGG - Intergenic
1124127316 15:26947793-26947815 CTGGCGACATCAGTGGAGGAGGG + Intronic
1124715896 15:32061273-32061295 GTGGCAACAGAAGAGGAGGAAGG + Intronic
1125927946 15:43578586-43578608 TTAGGAATATAAATGGAGGCTGG + Intronic
1125941089 15:43678157-43678179 TTAGGAATATAAATGGAGGCTGG + Intergenic
1127447438 15:59079046-59079068 TTGGGAACACAAATAGAGGAAGG + Intronic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1127866247 15:63035591-63035613 TCAGGAACTTCAGTGGAGGAAGG - Intergenic
1130389760 15:83445381-83445403 TTCTGAACAAAAGTGAAGGAAGG + Intergenic
1131602625 15:93864902-93864924 ATAGGAACAGAAGGGGAGGATGG - Intergenic
1131755158 15:95551523-95551545 TTGGGAAGAAAAGGGAAGGAGGG + Intergenic
1133439251 16:5806855-5806877 TTGGGAACATCAGTGGGCCAAGG - Intergenic
1135641432 16:24123104-24123126 ATGGGAAGAGAAGTGGATGAAGG + Intronic
1135763008 16:25152721-25152743 GTGGGGACAGAACTGGAGGATGG - Intronic
1135978214 16:27125205-27125227 TTGAGAACATCAGAGCAGGAAGG - Intergenic
1137717009 16:50604107-50604129 TAGACAAAATAAGTGGAGGAGGG + Intronic
1139697485 16:68685435-68685457 GTGGGAACATGTGTCGAGGAGGG + Intronic
1141048837 16:80742584-80742606 GTGGGTAGATAGGTGGAGGATGG + Intronic
1141420081 16:83908961-83908983 TTAGGAAGCTAAGTGGATGATGG + Intronic
1141564942 16:84895067-84895089 TTTGGAATACGAGTGGAGGAGGG - Intronic
1141788915 16:86219684-86219706 TTTGGAATCTAAATGGAGGAGGG + Intergenic
1142730498 17:1852086-1852108 ATGGGAACATGACTGGAGGCAGG - Intronic
1143969326 17:10783503-10783525 AGGGGAACATAAATGGAGGCTGG - Intergenic
1144484937 17:15656560-15656582 TGGGGCACATAAGGGGAGCAGGG - Intronic
1146426265 17:32742264-32742286 TTGGTATCTTCAGTGGAGGAGGG + Intronic
1148810965 17:50290779-50290801 TTGGGGACATAAGGAGAGGATGG - Intergenic
1149340842 17:55684752-55684774 ATGGGGACAAAAGTGGAGGATGG - Intergenic
1150213087 17:63452258-63452280 ATGGGGACAGGAGTGGAGGAGGG - Intergenic
1153394148 18:4598814-4598836 TAGAGAACAGAAATGGAGGATGG + Intergenic
1155166921 18:23239226-23239248 TTGGGAACATCAAATGAGGAGGG - Intronic
1159018607 18:63123942-63123964 ATGGGAACACTGGTGGAGGATGG - Exonic
1160767917 19:816651-816673 TTGGGTGCATGAGTGGATGATGG - Intronic
1163018532 19:14471025-14471047 GGGGGAACAAAAGTGGAGGAGGG - Intronic
1164762308 19:30737243-30737265 TTGGGAGCACAGGTGGGGGACGG + Intergenic
1166839135 19:45685766-45685788 TTGGGGAGATAAATGGAGGTGGG - Intergenic
1167663552 19:50810582-50810604 TTTGAAACATATGTTGAGGATGG + Intergenic
925384973 2:3455494-3455516 CTGGGAACAGTAGTGGGGGATGG - Intronic
925733577 2:6941549-6941571 TGAGGAATACAAGTGGAGGATGG + Intronic
925772149 2:7292876-7292898 TTTGGAAAATAAGTGGAGATAGG + Intergenic
926075813 2:9942020-9942042 TTGGGAAAATAACTGGCAGAGGG - Intergenic
928129558 2:28640020-28640042 TTAGTAACACAATTGGAGGAGGG - Intronic
928970888 2:37027714-37027736 TTGGGAAGATAAGTTGAAGAAGG - Intronic
928971639 2:37035894-37035916 TTGGCAACATCGGAGGAGGAGGG - Intronic
929982769 2:46697523-46697545 TTGGGCAAATAAGTGGATGGTGG + Intergenic
931218765 2:60270285-60270307 TGGGGCACATTGGTGGAGGAAGG - Intergenic
931720940 2:65067385-65067407 GGGGGAACAAAAGTGGGGGAAGG + Intronic
931895580 2:66726064-66726086 AAGGAAACATAAGTGGAGAACGG - Intergenic
932342395 2:70974573-70974595 TTGGGACCAGATTTGGAGGAAGG - Intronic
933766449 2:85712528-85712550 GTGGAACCAGAAGTGGAGGATGG + Intergenic
935819249 2:106877774-106877796 TAGGGAACAGAATTGTAGGAAGG - Intronic
937559298 2:123201676-123201698 CTGGGAAGAGTAGTGGAGGAGGG - Intergenic
938164954 2:129018129-129018151 TTGGGAATAAAATTGGGGGATGG - Intergenic
938601974 2:132851567-132851589 TTGGGAAGAGAACTGCAGGAAGG - Intronic
939417459 2:141918195-141918217 TTGGAAACTTCAGTGGAGGGAGG + Intronic
941432186 2:165426457-165426479 TTGTGTAAATAAGTGAAGGAAGG - Intergenic
941842226 2:170098596-170098618 TGGGGAAAGTCAGTGGAGGAAGG - Intergenic
942767910 2:179479039-179479061 TTGGAAACATAATGGGAGGGAGG - Intronic
947348793 2:229221343-229221365 GTGGGGACAGAAGTGGAGGAAGG - Intronic
948575793 2:238948702-238948724 GTGGGGACAGGAGTGGAGGAGGG - Intergenic
1171318091 20:24213241-24213263 TTGGGAACAAAATAGGAGGCAGG + Intergenic
1172462532 20:35130886-35130908 TGGGGAACATAAGATGAGTAAGG + Intronic
1172646715 20:36474790-36474812 TTGGAAAGAGAAGTGGAGGTGGG - Intronic
1173159116 20:40639319-40639341 TTTGGAAGATAAGTGGAGAATGG - Intergenic
1174156960 20:48521810-48521832 TGGGGAACATACCAGGAGGAAGG - Intergenic
1174342670 20:49907698-49907720 GTGGGAACAGTAGAGGAGGAGGG - Intronic
1174890853 20:54390536-54390558 TTGACAACATAAGTCCAGGATGG + Intergenic
1175446371 20:59022992-59023014 CTGGGAACACAAGCAGAGGAAGG + Intronic
1177140907 21:17356868-17356890 TTGGGAACCTAAGTGGGCAAGGG - Intergenic
1178148206 21:29764051-29764073 TCGGAAACATAATTGGAGGGAGG + Intronic
1181536935 22:23551215-23551237 TTGGGAGGATGATTGGAGGATGG - Intergenic
1181537103 22:23552068-23552090 ATGGGAAGATAAATGGAGAATGG - Intergenic
1184125418 22:42483291-42483313 TTGGAAAGAGAAGTGGAGGCAGG - Intergenic
1184133902 22:42534789-42534811 TTGGAAAGAGAAGTGGAGGCAGG - Intergenic
1184188410 22:42879333-42879355 TTGGGTTCATAAGTGGGGCATGG - Intronic
949773370 3:7603310-7603332 TTTGTAACCTAAGGGGAGGAAGG + Intronic
951024629 3:17816377-17816399 TTTGGAAAATAAGTGGGGTAAGG + Intronic
951903096 3:27676830-27676852 TTGGGAAATTAAAAGGAGGAAGG - Intergenic
952765171 3:36946882-36946904 TTGGGAAAAGTATTGGAGGAAGG - Intergenic
953664731 3:44917681-44917703 CTGGGGACATCAGAGGAGGATGG - Intronic
953839128 3:46374661-46374683 TTGGGAAGACATGGGGAGGAAGG + Exonic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
956310147 3:67869795-67869817 ATGGAAACTTAAGTGTAGGATGG + Intergenic
958733619 3:97985805-97985827 TTGTGAGCATAAGTGGAGAGGGG - Intergenic
959039511 3:101405005-101405027 TTGGGAACAAAAGGGGATAATGG + Intronic
960218447 3:115072722-115072744 TTTGGAACAGTAGTGGAGAAGGG - Intronic
961879262 3:130049244-130049266 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
963048644 3:141123772-141123794 TTGGGAAGATCCGTGGAGCAGGG + Intronic
965553296 3:169992618-169992640 TTTGGCTCATAACTGGAGGAAGG + Exonic
966412503 3:179657855-179657877 TTGTGTGCTTAAGTGGAGGAGGG + Intronic
966585585 3:181620674-181620696 TTGGGAGCATGAGAGGAAGAGGG - Intergenic
968914514 4:3491560-3491582 GTGGAACCATAAGTGAAGGAAGG - Intronic
968991491 4:3916268-3916290 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
969171339 4:5366321-5366343 TTGGGAAGGTAAGAGGAAGAAGG - Intronic
969663859 4:8545699-8545721 TGGGGAACACAAGGGGAGGACGG - Intergenic
969885928 4:10215402-10215424 AAGGGAATCTAAGTGGAGGAGGG + Intergenic
969957309 4:10904017-10904039 CTGGGAACAGAAGTGGTGGTAGG + Intergenic
970755881 4:19426132-19426154 TTTCTAACATAAGTGGATGAAGG - Intergenic
972738786 4:41870809-41870831 TAAGGAACAGAAGAGGAGGAGGG + Intergenic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
974613447 4:64248128-64248150 TTGAGAATAGAATTGGAGGAAGG - Intergenic
975452713 4:74548392-74548414 TGGGAATCATAAGTGGATGAAGG - Intergenic
976577786 4:86695328-86695350 ATGGGGACATAAGTATAGGAAGG - Intronic
978627186 4:110700660-110700682 TTGGGACCTAAAGTGCAGGAAGG + Intergenic
980889457 4:138798568-138798590 CTGGGAGCAGCAGTGGAGGAGGG + Intergenic
982117718 4:152112113-152112135 TAGGGAGGATGAGTGGAGGAGGG + Intergenic
982571498 4:157056322-157056344 TGGGTAACATAAGTGAAAGATGG - Intergenic
982781165 4:159492849-159492871 TTTGAAATCTAAGTGGAGGAAGG - Intergenic
982995728 4:162342189-162342211 GTGGGGAAATAATTGGAGGATGG + Intergenic
984079513 4:175228382-175228404 TGGGGAACAAATGTGGAGAAAGG + Intergenic
984326795 4:178265248-178265270 CTGGGAACCTAAGAGGACGAAGG + Intergenic
986618419 5:9644225-9644247 TGGAGAACATATGTGGAGGTTGG + Intronic
992137113 5:73758050-73758072 CTGGGAACACAAGTGGAGGGAGG - Intronic
992227066 5:74629187-74629209 TTTGGAGCATAACTGGAGGGTGG - Exonic
992412372 5:76518557-76518579 TCAGGGACATAAGTGGAAGAAGG + Intronic
996269148 5:121581012-121581034 TTGGAGTCAAAAGTGGAGGAAGG - Intergenic
996772560 5:127100364-127100386 TAGGGAAAATAAGTGGACCATGG + Intergenic
998753637 5:145352156-145352178 TGGGGACTATATGTGGAGGAGGG + Intergenic
1000915432 5:167075424-167075446 TTGGGAAAGTAGGTAGAGGATGG + Intergenic
1001232783 5:170003765-170003787 TTGGGAACAAGAGTGAAGAAAGG + Intronic
1001851615 5:174972515-174972537 GTGGGAAGACAAGTGGAGAAGGG - Intergenic
1004549773 6:16635787-16635809 CTGAAAACATGAGTGGAGGAAGG + Intronic
1004677548 6:17858556-17858578 TTGGGAACATACGTGGAATAAGG - Intronic
1005368579 6:25105936-25105958 TTGGAAACATGAGTTGAGAATGG - Intergenic
1007329603 6:41095063-41095085 AGGGGAACAAAAGTGGAAGAAGG - Intronic
1007850534 6:44798637-44798659 ATGTGAACCTAGGTGGAGGAGGG + Intergenic
1008090184 6:47285946-47285968 TTGGGAACATAAGTGGAGGAAGG + Exonic
1008141223 6:47834685-47834707 CTGGGAAAATGAGTGGAGAAGGG - Intergenic
1008494511 6:52119042-52119064 TTGGGAAGATGAGTTGGGGAAGG - Intergenic
1008744192 6:54648688-54648710 TTGGGAACATATGTGTTGGGTGG + Intergenic
1008975557 6:57421697-57421719 TTGGCAACATAAGAGGAAGTGGG - Intronic
1009310668 6:62148566-62148588 TTAGGAACAAAATTGGAGGCAGG - Intronic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1011055666 6:83200909-83200931 CTGGAAAAATAAGTGGGGGATGG + Intergenic
1011552160 6:88539778-88539800 TTAGGAAAACAAGAGGAGGAAGG + Intergenic
1012109073 6:95203283-95203305 TAGGGAGGATAAGGGGAGGAGGG + Intergenic
1013439861 6:110152901-110152923 TTGGAAACATGAGGGGAGGAAGG - Intronic
1016120243 6:140335221-140335243 ATGGCAGCATAAGTGGGGGAGGG + Intergenic
1016555696 6:145334676-145334698 TTTGGTACATATGTGGAGAATGG - Intergenic
1020065192 7:5183011-5183033 AAGGGTACATGAGTGGAGGAAGG - Intergenic
1020888105 7:13844778-13844800 TTGGGAGCATAAGTTCTGGAGGG - Intergenic
1023532399 7:41172166-41172188 TTAGGAACAAAAGTGGAATAAGG - Intergenic
1024234841 7:47390205-47390227 TTGACAACTTTAGTGGAGGAGGG - Intronic
1024997849 7:55287565-55287587 CTGAGCACCTAAGTGGAGGAGGG + Intergenic
1025041579 7:55650668-55650690 TTGGCAAAATAAGTGGTGAAGGG + Intergenic
1027440121 7:78210428-78210450 TTGGGAACTTGAGTGTATGATGG + Intronic
1029538217 7:101168183-101168205 TTGTGAGCTTAAGTGGAGGAAGG - Intergenic
1030992433 7:116316489-116316511 TTGGGAACACAAGTCAAAGAAGG + Intronic
1033621752 7:143068114-143068136 TTGGGAAGATAAATGCAAGAGGG - Intergenic
1033847055 7:145446373-145446395 TTCTGAAGATAAGTGGAGGGGGG + Intergenic
1034074840 7:148221760-148221782 TTGGGAACACAAGTGTCTGATGG - Intronic
1034292786 7:149945928-149945950 CTGGGAACAGGTGTGGAGGAGGG + Intergenic
1034533529 7:151712495-151712517 TTTGTTACATCAGTGGAGGAAGG - Intronic
1035256762 7:157634022-157634044 TGGGGAACAGCAGTGGAGGCGGG + Intronic
1036329439 8:7808441-7808463 TTGGATACATAAGTAGTGGAAGG + Intergenic
1037084125 8:14826087-14826109 TTGGGGACATAGGTGGGGGGAGG - Intronic
1037233985 8:16694722-16694744 CTGGGATCATAAGTGGACAAAGG + Intergenic
1037980237 8:23247964-23247986 CTGGGAACAAAAGTAGAGAAGGG - Intronic
1041787507 8:61650756-61650778 TCAGGAACAGAAGGGGAGGATGG - Intronic
1045378011 8:101594386-101594408 TTGAGGAAATAAGTTGAGGAAGG + Intronic
1047253073 8:123195118-123195140 TTGGGAACATTTGTTTAGGAAGG + Intronic
1047762493 8:127964382-127964404 GTGGGAGCAGAACTGGAGGATGG + Intergenic
1051224491 9:14884568-14884590 TTAGTAACATAATTGGTGGAGGG + Intronic
1051749969 9:20330606-20330628 TTGGTAACAAATGGGGAGGAAGG - Intergenic
1053026148 9:34729945-34729967 TTGGTAACAGAGGTGCAGGAAGG + Intergenic
1053804739 9:41789991-41790013 TTGGGAACAAAATGGGAGGCTGG - Intergenic
1054762343 9:69014206-69014228 CTGGGAATATAAGCGGAGGCCGG - Intergenic
1056486380 9:87062260-87062282 TTGAGAACAGAAGTGGATAATGG + Intergenic
1056786941 9:89599919-89599941 TTTGGAACATAAAAGAAGGAAGG + Intergenic
1057253799 9:93526542-93526564 ATGGGAACTTATTTGGAGGATGG - Intronic
1058002413 9:99879593-99879615 TTGGAAACCTGAGTGGATGATGG + Intergenic
1058436323 9:104967102-104967124 TTGGGAACTTAAATGCAGAATGG - Intergenic
1059106554 9:111516752-111516774 TTGGGAAAAGAAGGGGAGCACGG - Intergenic
1060252019 9:121994293-121994315 TGGAGAACATAAGAGGTGGAGGG + Intronic
1061233846 9:129330711-129330733 TTGGGAACATAGTCGGTGGAAGG + Intergenic
1189752202 X:44233757-44233779 TGGGGAACATAACTGATGGAAGG + Intronic
1189849563 X:45165171-45165193 TAGGGAACAGAAGGGGAGCAAGG + Intronic
1189940982 X:46120702-46120724 TTGGTAATATAAGGTGAGGAGGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190917433 X:54821131-54821153 GTGGGAAAATTAGTGCAGGAAGG - Intergenic
1191859387 X:65653511-65653533 TTAGGAACGTAAGTGGTGGGAGG + Intronic
1192286710 X:69746074-69746096 ATGAGAAAATAAGTGGGGGAAGG - Intronic
1192634321 X:72803621-72803643 TGGGGAAAATTAGTGGAGGAGGG - Intronic
1192647389 X:72917180-72917202 TGGGGAAAATTAGTGGAGGAGGG + Intronic
1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG + Intergenic
1194067316 X:89277290-89277312 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1194404610 X:93479689-93479711 TTGAGAACAGAAGGAGAGGAGGG + Intergenic
1197306800 X:124852451-124852473 TTTGGAACAGAATTGGAGGCAGG + Intronic
1199452451 X:147991613-147991635 TTGTGATGATAAGTGAAGGAAGG - Intronic
1199514771 X:148663874-148663896 ATGGGAACATAAAGGGAGGGAGG + Intronic
1199522908 X:148756982-148757004 TGGGGAACATAATATGAGGAGGG + Intronic
1200721475 Y:6611504-6611526 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1201010616 Y:9546451-9546473 CTGGGAACGTACCTGGAGGACGG - Intergenic
1201269181 Y:12237839-12237861 TTGGGAAGATAAATACAGGAGGG - Intergenic
1201305868 Y:12550167-12550189 ATGGGAAGGTAAGTGGTGGATGG + Intergenic
1202197624 Y:22310420-22310442 GTGGGAAGATCAGTGGAGGCTGG + Intronic