ID: 1008092183

View in Genome Browser
Species Human (GRCh38)
Location 6:47305203-47305225
Sequence CCATACGAATTGTACCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008092180_1008092183 11 Left 1008092180 6:47305169-47305191 CCAGCACTGGTGATGGCCATGCT 0: 1
1: 1
2: 0
3: 14
4: 171
Right 1008092183 6:47305203-47305225 CCATACGAATTGTACCTTCATGG 0: 1
1: 0
2: 0
3: 3
4: 55
1008092178_1008092183 16 Left 1008092178 6:47305164-47305186 CCCAACCAGCACTGGTGATGGCC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1008092183 6:47305203-47305225 CCATACGAATTGTACCTTCATGG 0: 1
1: 0
2: 0
3: 3
4: 55
1008092179_1008092183 15 Left 1008092179 6:47305165-47305187 CCAACCAGCACTGGTGATGGCCA 0: 1
1: 0
2: 1
3: 23
4: 171
Right 1008092183 6:47305203-47305225 CCATACGAATTGTACCTTCATGG 0: 1
1: 0
2: 0
3: 3
4: 55
1008092181_1008092183 -5 Left 1008092181 6:47305185-47305207 CCATGCTCATTTTATATACCATA 0: 1
1: 0
2: 2
3: 20
4: 413
Right 1008092183 6:47305203-47305225 CCATACGAATTGTACCTTCATGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008092183 Original CRISPR CCATACGAATTGTACCTTCA TGG Intronic
917483200 1:175431174-175431196 CCATACCAAATGGACCTTTAGGG + Intronic
1063355404 10:5394227-5394249 GCACACGGACTGTACCTTCATGG - Exonic
1068324999 10:55473409-55473431 CAATAAGAATTTTACCTTGAAGG + Intronic
1069697030 10:70394082-70394104 CCCTATGAGTTCTACCTTCATGG - Intergenic
1075244031 10:120804578-120804600 CCAGACACATTGTAGCTTCATGG - Intergenic
1076612388 10:131734400-131734422 CCATATGAATTGTGCCTGAATGG - Intergenic
1078895899 11:15596896-15596918 CCATAGGAGCTGTACATTCATGG + Intergenic
1094388513 12:29921609-29921631 CCATATGGCTTGAACCTTCATGG + Intergenic
1102245537 12:111353496-111353518 CCCCACTACTTGTACCTTCATGG - Intergenic
1103006210 12:117422475-117422497 TCATATGAATTTCACCTTCAAGG + Intronic
1106960955 13:34997327-34997349 CTATTCGAATTGTTCCCTCATGG - Intronic
1107988042 13:45792656-45792678 CCTTAATAATTATACCTTCATGG - Intronic
1108169719 13:47728550-47728572 CCATAGTAAATGTAACTTCAGGG + Intergenic
1110834667 13:80070051-80070073 ACAAACGAATTGAACCTTAAGGG + Intergenic
1112527058 13:100159856-100159878 GCATATGAACTGTGCCTTCAAGG - Intronic
1112578557 13:100659139-100659161 CCATGCAAATTGTACCTACTGGG - Intronic
1117312072 14:54536475-54536497 CCATTGGAATTGTACCTTTTTGG + Intronic
1119917769 14:78418097-78418119 CCATACAAATTTCACCTTCATGG - Intronic
1126301808 15:47205346-47205368 CTATACGAAGTACACCTTCAAGG - Intronic
1130712519 15:86297658-86297680 CCATACAAATAGTATTTTCAGGG - Intronic
1156049208 18:32911679-32911701 CAAGACCAATTGTACCTTCAAGG - Intergenic
1158075011 18:53517802-53517824 CCATGTGAATTGTACTTTAAGGG - Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
926799320 2:16645552-16645574 CCACATGTATTCTACCTTCAAGG + Intronic
930361582 2:50387136-50387158 CCAGACAAATTGTATATTCATGG - Intronic
931370837 2:61661121-61661143 GCATATGAACTGGACCTTCATGG - Intergenic
932965497 2:76469775-76469797 CCATTTCAATTGTACCTTAAGGG - Intergenic
933937158 2:87216161-87216183 ACATAAGAATCGTACGTTCATGG + Intergenic
935930504 2:108119283-108119305 CCATATGAATGGTTGCTTCAAGG - Intergenic
936355984 2:111749663-111749685 ACATAAGAATCGTACGTTCATGG - Intergenic
945382166 2:209153845-209153867 CCATAGGAAATTTACCATCATGG - Intergenic
947979995 2:234400371-234400393 CCATACGAATAATAACTCCAGGG - Intergenic
1172920915 20:38481104-38481126 GCATACGAATTGTGCATTGAAGG - Intronic
1175104964 20:56608526-56608548 CCATACCATTTCTACCATCAGGG + Intergenic
1178383218 21:32128879-32128901 CCTTATGAATTGTACCTCCTTGG - Intergenic
950250285 3:11459557-11459579 CAACATGAATTGTAACTTCATGG + Intronic
952158620 3:30670836-30670858 GCATACGAATTGTAGTTTCATGG - Intronic
957727445 3:84086526-84086548 CCATTTGAATTATGCCTTCATGG - Intergenic
960789485 3:121412399-121412421 CCATACTACTGCTACCTTCAGGG + Intronic
962366704 3:134791422-134791444 CCAAACCAATGGTGCCTTCAGGG + Intronic
969111614 4:4847935-4847957 ACATACGCACTGTAACTTCATGG - Intergenic
975341587 4:73248143-73248165 CCATTCTAATTTTACCTTGAAGG - Intronic
983159951 4:164400286-164400308 AAATATGAATTTTACCTTCAAGG + Intergenic
995228346 5:109729298-109729320 CCATACGAATTAGACCTTTGTGG + Intronic
996651456 5:125882020-125882042 CCATAAGAATGGTAAGTTCAGGG - Intergenic
998356814 5:141545301-141545323 CTAAACAAATTGTATCTTCAAGG + Intronic
1004961431 6:20793684-20793706 CCATACAAATTGAAACTTAATGG - Intronic
1008092183 6:47305203-47305225 CCATACGAATTGTACCTTCATGG + Intronic
1028734804 7:94196722-94196744 CCATTAGAATTATAGCTTCATGG - Intergenic
1047018699 8:120751448-120751470 CCATACGAATTAAATCTTAAAGG + Intronic
1050056676 9:1662559-1662581 CCATATAAATTGTAATTTCAAGG + Intergenic
1058656514 9:107226824-107226846 CCACACGAATTGGAAATTCAGGG - Intergenic
1185737428 X:2503929-2503951 CCATAGGAATTGAACCCTCCAGG + Intergenic
1189037453 X:37506856-37506878 CCTTACGAATTCTCCATTCATGG + Intronic
1189348382 X:40259579-40259601 CCAAAAGACTTTTACCTTCAAGG - Intergenic
1194199424 X:90936543-90936565 CCATTTGAATTGTACAGTCAAGG + Intergenic
1197177894 X:123504310-123504332 CCATTCCAACTGTACATTCAGGG - Intergenic
1198990367 X:142507077-142507099 GCATACGAATTGTGATTTCAGGG - Intergenic
1200545415 Y:4512962-4512984 CCATTTGAATTGTACAGTCAAGG + Intergenic