ID: 1008092798

View in Genome Browser
Species Human (GRCh38)
Location 6:47309539-47309561
Sequence TCCAGCTGCCCCGCGCGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008092798_1008092805 25 Left 1008092798 6:47309539-47309561 CCGGGGCGCGCGGGGCAGCTGGA 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1008092805 6:47309587-47309609 CGCATCCACCGCCGCCTCCCGGG 0: 1
1: 0
2: 4
3: 87
4: 2586
1008092798_1008092808 30 Left 1008092798 6:47309539-47309561 CCGGGGCGCGCGGGGCAGCTGGA 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1008092808 6:47309592-47309614 CCACCGCCGCCTCCCGGGCCGGG 0: 1
1: 0
2: 9
3: 86
4: 594
1008092798_1008092804 24 Left 1008092798 6:47309539-47309561 CCGGGGCGCGCGGGGCAGCTGGA 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1008092804 6:47309586-47309608 CCGCATCCACCGCCGCCTCCCGG 0: 1
1: 1
2: 5
3: 59
4: 653
1008092798_1008092806 29 Left 1008092798 6:47309539-47309561 CCGGGGCGCGCGGGGCAGCTGGA 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1008092806 6:47309591-47309613 TCCACCGCCGCCTCCCGGGCCGG 0: 1
1: 1
2: 2
3: 30
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008092798 Original CRISPR TCCAGCTGCCCCGCGCGCCC CGG (reversed) Exonic
900127340 1:1074395-1074417 TCCAGCTGCCTGGCCCGCCAAGG - Intergenic
900349743 1:2228685-2228707 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
900633754 1:3652027-3652049 TCCAAGCGCCCCGCGCGCCGAGG + Intronic
901064942 1:6490122-6490144 CCCAGCCACGCCGCGCGCCCGGG + Intronic
901438772 1:9264943-9264965 GCCACCTGCCCAGCGTGCCCTGG + Exonic
901632693 1:10655614-10655636 TGCAGCTGCCCAGTGGGCCCGGG + Intronic
901664506 1:10818792-10818814 TCCAGCTGCACCCTCCGCCCTGG + Intergenic
902044333 1:13513728-13513750 TCCATCGCCCCCGCACGCCCGGG - Exonic
902628559 1:17690811-17690833 TGCAGCTGCCCCCCACGCTCTGG - Intronic
903142270 1:21345676-21345698 TCCAGGTTCCCCGCGCAGCCCGG - Intergenic
903263303 1:22142757-22142779 GCCCGCTGCCCCGCGCCGCCTGG + Intronic
905653552 1:39671991-39672013 CCCAGGAGCCCCGCGAGCCCGGG - Exonic
906680924 1:47725109-47725131 CCCAGCCAGCCCGCGCGCCCAGG - Intergenic
907091892 1:51732817-51732839 TCCAGCTGCCCAGCATGTCCTGG + Intronic
907304686 1:53506989-53507011 CCCAGCTGCCCTGGGCCCCCTGG - Intronic
907444437 1:54498971-54498993 TCCAGCTGCCCTGCAGGACCTGG + Intergenic
907880715 1:58546844-58546866 CCCAGCTGCCCCGGGCCCCGCGG + Intergenic
912502278 1:110130349-110130371 TCCAGCGGTCCCCCGCCCCCAGG - Intergenic
912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG + Intronic
915266098 1:154719141-154719163 TCCAGCAGCCCCAGGAGCCCTGG + Intronic
915345511 1:155195111-155195133 CCCAACTCCCCAGCGCGCCCCGG + Intergenic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
916179291 1:162070048-162070070 TCCCCCTGCCCAGCGCTCCCAGG + Exonic
920191997 1:204199676-204199698 TCCACCTGCCCCGGGTGTCCTGG + Intronic
920194042 1:204214139-204214161 TCCACCTGCCGCGCCTGCCCGGG + Intergenic
920250459 1:204619231-204619253 ACCAGCTGGCCCGGGTGCCCAGG - Exonic
922602836 1:226870476-226870498 GCCACCCTCCCCGCGCGCCCGGG + Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1063393682 10:5666599-5666621 CCCAGCGGCCCCGCGCGGCCCGG - Intergenic
1067497669 10:46774574-46774596 ACCAGCTGGTCCGCGCGTCCCGG + Intergenic
1067596981 10:47565840-47565862 ACCAGCTGGTCCGCGCGTCCCGG - Intergenic
1069534362 10:69241962-69241984 TCCAGCTGACCCCCTCGCTCTGG - Intronic
1069615335 10:69802969-69802991 TCCACCTGCCCGGCGTGCCCAGG - Intronic
1070450070 10:76549138-76549160 TTCAGCTGCCCTGGGAGCCCAGG + Intronic
1072634208 10:97166920-97166942 GCCATCTGACCCGCGGGCCCAGG + Intronic
1074377396 10:112951321-112951343 GCCGGCCGCCCCGCGCGCCCCGG + Intronic
1074377697 10:112952425-112952447 CCCTGCTGCCCTGCGCGGCCCGG - Intronic
1075801745 10:125159085-125159107 TCGCGCTGCCCCCAGCGCCCCGG - Intronic
1076023677 10:127094542-127094564 TCCAGCTGCCTCGCTGTCCCAGG - Intronic
1076667932 10:132103401-132103423 TCCAGCTGCTCCTCTCCCCCAGG - Intergenic
1076710547 10:132331683-132331705 TCGAGCAGCCCCGCCCGCCCCGG + Intronic
1076858629 10:133129308-133129330 TACAGCTGCCCCACGCAGCCGGG + Exonic
1077090853 11:777607-777629 GCCCGCCGCTCCGCGCGCCCGGG + Exonic
1077094249 11:792632-792654 TCCAGCTGCCCCTCGGCCCACGG - Exonic
1077201407 11:1309332-1309354 GCCAGGCGCCCCGCGTGCCCCGG + Intronic
1077514727 11:2994535-2994557 TCCAGCTGCCCCCAGCCCCAAGG - Intergenic
1077554304 11:3218582-3218604 TCAGGCTGCCCTGGGCGCCCAGG - Exonic
1079116928 11:17645947-17645969 TCCAGCTAGCCCGGGCCCCCAGG - Intronic
1083457112 11:62786694-62786716 TCCTCCGGCCCCGCGCCCCCTGG - Exonic
1083842824 11:65314694-65314716 TCCAGCGGTCGCGCGCGCCCTGG - Intergenic
1084209837 11:67615825-67615847 TCTAGCTGCCCTGGGCACCCTGG - Intergenic
1084517288 11:69643765-69643787 GCCGGCTTCCCCGCGCCCCCGGG + Intronic
1084526662 11:69702467-69702489 TCCCGCGGCCCCGCGCGCAGAGG - Intronic
1088645332 11:111912745-111912767 TCCAGCTGCCCGGAGAGCCAGGG - Exonic
1088683548 11:112265804-112265826 TCCAGCTACCCCCAGCTCCCTGG - Intronic
1090293848 11:125569446-125569468 CCCAGCGGCCCCGTGCGGCCCGG + Exonic
1091385985 12:94926-94948 TCCAGCTGCTCCGGGGTCCCAGG - Intronic
1091616105 12:2052642-2052664 CCCGGGTGCGCCGCGCGCCCCGG + Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096647684 12:53047448-53047470 TCCGGCGGCCCCGCGCCCCCTGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1101254714 12:102965749-102965771 CCCTGCTCCCCCGCGGGCCCGGG + Intergenic
1102687623 12:114736613-114736635 TCCTCCTCCCCCGCGCCCCCTGG + Intergenic
1102853859 12:116277216-116277238 CCCGGCCGCCCCGCGCTCCCCGG - Exonic
1103322090 12:120098169-120098191 TCCAGCTGGGCCGGGCGCGCCGG - Intronic
1103713500 12:122929817-122929839 CCCAGCTGCCCTCCGAGCCCAGG - Exonic
1105000724 12:132688068-132688090 AACAGGGGCCCCGCGCGCCCGGG + Intronic
1105725735 13:23160413-23160435 CCCCGCCTCCCCGCGCGCCCCGG + Intergenic
1106226485 13:27790552-27790574 GGCAGCCGCCCCGCGTGCCCGGG - Intergenic
1108618525 13:52159243-52159265 TGCAGTTGCCCCGCGGGCGCCGG - Intronic
1111125285 13:83906709-83906731 CCCAGCTGCCCCGCTTTCCCTGG + Intergenic
1112506340 13:99978561-99978583 TCCAGGGGCCGCGCGCGGCCGGG - Intergenic
1114483248 14:23048047-23048069 TCCAGCGGCTCCGCGGGGCCGGG + Exonic
1115849989 14:37583748-37583770 CCCTTCTGCCCAGCGCGCCCCGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116956407 14:50928096-50928118 TCCAGCTGCCACCTGCACCCAGG - Intronic
1117478334 14:56118838-56118860 TCCTGCCGCCCCGAGCGCCCCGG - Intronic
1118363901 14:65077883-65077905 GCCAGCTGCCCCACGAGCTCGGG + Intronic
1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG + Intergenic
1118925786 14:70188785-70188807 GCAAGCAGCCCGGCGCGCCCTGG + Exonic
1121444236 14:93968596-93968618 CCCAGCTGCCCAGCACCCCCTGG + Intronic
1122047562 14:99034749-99034771 TCCTGAAGCCCCGCCCGCCCAGG + Intergenic
1122910861 14:104826976-104826998 TCCAGCTTCCCTGGGAGCCCGGG - Intergenic
1123112529 14:105880034-105880056 CCCAGCTGCCCTGCTCTCCCTGG - Intergenic
1202864278 14_GL000225v1_random:104976-104998 TCCACATGCCCTGCGCGCCTGGG - Intergenic
1202921956 14_KI270723v1_random:35245-35267 CCCACCTGCCCTGCGCGCCTGGG + Intergenic
1124118428 15:26867961-26867983 TCCAGCTCCCCGGCCCTCCCCGG - Intronic
1126299982 15:47184546-47184568 TCCAGCCTCCCGGCGCGCCGCGG + Intronic
1128315092 15:66655085-66655107 TCCCGCTGCCCCGGCCTCCCAGG + Intronic
1128982460 15:72197549-72197571 CAGAGCTGCACCGCGCGCCCAGG - Intronic
1131838092 15:96409891-96409913 CCCACCAGCCCCGCGCGGCCCGG + Intergenic
1132373883 15:101315857-101315879 TCCAGGTGCCCCGTGTGTCCTGG - Intronic
1132406408 15:101544037-101544059 GCCCCCTGCCCCGCGCGCGCAGG + Intergenic
1132553840 16:564252-564274 TCCAGCTCCCCCTCCTGCCCTGG - Exonic
1132585146 16:702919-702941 TCCTCCTGCCCCGCTCTCCCTGG + Intronic
1132588308 16:715600-715622 GCCAGCTGCCCCACGCTGCCGGG - Exonic
1132692195 16:1186652-1186674 TCCTCCTGCCCCGTGTGCCCTGG + Intronic
1132723858 16:1330416-1330438 TCCTGCTGCCACGCGTGCACAGG - Intergenic
1132801734 16:1757966-1757988 TCCCGGTGCCCCGTGTGCCCAGG - Intronic
1132834056 16:1943499-1943521 CCCTGCCGCCCCTCGCGCCCTGG + Intergenic
1132915170 16:2340264-2340286 TCGAGCTTCCCCGCGCGGCGCGG + Intronic
1133344424 16:5060411-5060433 TCCAGCTGACCCTCCAGCCCGGG - Exonic
1134121338 16:11586843-11586865 TCCCGCTGGTCCCCGCGCCCCGG + Intronic
1135407099 16:22206461-22206483 TCCGACTGCCCCGCGCGCCCTGG + Exonic
1137388299 16:48060148-48060170 TTCAGCGGTCCCGCGGGCCCCGG + Intergenic
1137475988 16:48810755-48810777 TCCAGCTTCCCCGCGGGTCCGGG + Intergenic
1137561149 16:49503205-49503227 TCCAGCAGCCCCACCTGCCCAGG + Intronic
1137677643 16:50311605-50311627 TCCAGGTGCCACGCACACCCAGG - Intronic
1138450857 16:57092801-57092823 CCAAGCTGCCCCGCCTGCCCGGG - Intronic
1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG + Intronic
1141447418 16:84070425-84070447 TCCAGCTGCTCCGGAGGCCCTGG + Intronic
1141649358 16:85384970-85384992 CACACCTGCCCCGCCCGCCCTGG + Intergenic
1142276809 16:89123139-89123161 TACAGCTGCCCTGCGGGGCCTGG + Intronic
1142307133 16:89292069-89292091 TCCAGCTGCCCTGCGGGTTCTGG + Intronic
1142412200 16:89922635-89922657 TCCAGGTGCTGTGCGCGCCCGGG + Intronic
1142695166 17:1629242-1629264 CCCAGCTGCCCCCTGCGCGCGGG + Intergenic
1142742553 17:1939769-1939791 CCCAGCTGCCCCAGGCGGCCAGG + Intronic
1143030488 17:3964528-3964550 TCCGGCCGCCCTCCGCGCCCCGG + Intergenic
1143784295 17:9245169-9245191 ACCAGCGGCCCCGCTGGCCCTGG - Intergenic
1144208191 17:12993919-12993941 ACCAGCTTCCCCGGGTGCCCTGG - Intronic
1144840754 17:18184193-18184215 CCCGGCTGCCCCGCCCGCCCCGG + Intronic
1146445258 17:32928018-32928040 CCCAGCTGCCCCGGCCGCCGGGG + Exonic
1147743770 17:42683064-42683086 TGAGGCTGCCGCGCGCGCCCGGG + Intronic
1148553546 17:48564538-48564560 TCCCGCAGCCCTGCGCGGCCCGG - Intronic
1148564731 17:48626133-48626155 TCCAGGTGCTCCGCGTGGCCCGG + Exonic
1151727169 17:75891951-75891973 TCCAGCTGCCCCTCCCGCTGGGG - Intronic
1151933367 17:77247085-77247107 TCCCTCTGCCCCGCCGGCCCAGG - Intergenic
1152040020 17:77897129-77897151 TCCAGCTCCCCCCTGCTCCCAGG + Intergenic
1152683740 17:81683646-81683668 TCCGGGTGCCCCCCGCGCCCCGG + Intronic
1152721829 17:81927304-81927326 TCCTCCTGCCCCTGGCGCCCGGG - Intronic
1152728749 17:81959978-81960000 TCAAGCGCCGCCGCGCGCCCCGG - Intronic
1152729201 17:81961479-81961501 TCCAGCTGCCCCGCGGGGGGGGG - Intronic
1152903076 17:82956485-82956507 TCCAGCTGCCTCCTGCCCCCAGG + Intronic
1153794282 18:8608945-8608967 TCCAGCTACACCGAGCGCGCGGG + Intergenic
1155508055 18:26550063-26550085 CGCAGCTGGCCCGCGCGCCAGGG - Intronic
1157412733 18:47477042-47477064 TCCAGGTGCCCTGCCCTCCCGGG - Intergenic
1159943838 18:74428990-74429012 TCCTGCTGCCCAGCTTGCCCAGG + Intergenic
1160716228 19:578056-578078 ACCACCTGACCCGGGCGCCCAGG + Exonic
1160775443 19:853137-853159 TCGAGGGGCCCCGCGGGCCCTGG - Intronic
1160795333 19:942656-942678 TCCCACTGCCCCGCAGGCCCTGG + Intronic
1160990214 19:1857353-1857375 CCCAGCTGCTCCGCGCTACCTGG + Intronic
1161241104 19:3224548-3224570 GCCGGCTGCCCCGCGCGGCGCGG + Intergenic
1161477204 19:4493487-4493509 AGCAGCTGCCCGGCGTGCCCAGG + Intronic
1162030787 19:7916490-7916512 TCGAGCGGCCCCGCGCGGCGAGG - Exonic
1162100471 19:8335631-8335653 CCCCGCTGCCCGCCGCGCCCCGG - Exonic
1162145514 19:8610684-8610706 TCTCGCCGCCCCGCGCGCGCAGG + Intronic
1163715179 19:18869117-18869139 CCCAGCAGCTCCGCGCGCACTGG + Exonic
1163860619 19:19740902-19740924 TACAGCTGCCCTGCCCGCGCAGG + Intergenic
1165305563 19:35000654-35000676 CCCAGCTGCACCCCTCGCCCGGG - Intronic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1166677277 19:44747855-44747877 CCCCGGTGCCCCGCGGGCCCCGG + Intronic
1168154017 19:54463360-54463382 TCCGGCTGCGCCTCGCGGCCAGG + Exonic
1168242917 19:55096221-55096243 TCCAGCCACCCCGCCAGCCCTGG + Intronic
1168287247 19:55340896-55340918 TCCAGCTTCCCCGCTGTCCCTGG + Intronic
925990354 2:9249735-9249757 TGCAGCTCCCCCGCCAGCCCGGG - Intronic
928175163 2:29028422-29028444 TCCAGCAGCCCCGCCCTGCCTGG + Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
933667071 2:84971884-84971906 TCCTGCTGCCGCCCGCGGCCCGG - Intronic
934040500 2:88124237-88124259 TCCACCTGCCCTGCATGCCCAGG - Intronic
934113724 2:88765243-88765265 TGCCGCTGCCCCGCTGGCCCCGG - Intergenic
935203235 2:100876493-100876515 TCCAGCTGCCCTAGGGGCCCAGG + Intronic
937255447 2:120552234-120552256 TCCAGCTGCGCCCAGCCCCCTGG - Intergenic
937354227 2:121187956-121187978 TCCAGCTGCTCTGGGGGCCCAGG + Intergenic
938381177 2:130837304-130837326 TCCGAGTGCCCCGCGCGCCCAGG - Intronic
938381188 2:130837344-130837366 TCCGAGTGCCCTGCGCGCCCAGG - Intronic
941367048 2:164621626-164621648 GCCAGTGGCCCCGAGCGCCCCGG - Exonic
942278662 2:174340723-174340745 TCAAGGTTCCCCGCGCCCCCAGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
944451767 2:199850975-199850997 GCCGGCTGCCCCTCGCTCCCAGG - Exonic
944630427 2:201618842-201618864 TCCAGGTGCCCTGCTGGCCCCGG + Intronic
946095831 2:217273459-217273481 TCCAACTGCCCCAGGTGCCCAGG + Intergenic
947117962 2:226791742-226791764 CCCAACCGCCCCGCCCGCCCGGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947588429 2:231370944-231370966 CCCAGCTGACCAGAGCGCCCAGG - Intronic
948430317 2:237914319-237914341 TTCAGCAGCCCCGCGGCCCCCGG + Intergenic
948604768 2:239127856-239127878 CCCAGCTGCCCTGCGAGCCCTGG - Intronic
948679800 2:239626059-239626081 TCCAGCAGCCCTGCCCGCCCCGG - Intergenic
948862000 2:240757194-240757216 TCCACCTGCCTCGCCTGCCCTGG + Intronic
948983976 2:241508813-241508835 ACCACGTGCCCCGCCCGCCCAGG - Intronic
1172409342 20:34710113-34710135 TCCAGCAGCGCCGCCCGCGCTGG - Exonic
1172464582 20:35146754-35146776 CCCAGCTGACCCGCCCGCCGAGG + Intronic
1174130391 20:48340178-48340200 TCCACCTGCCCCTCCAGCCCTGG + Intergenic
1175189210 20:57199825-57199847 TCCAGGTGCTGTGCGCGCCCAGG - Intronic
1175399617 20:58692986-58693008 ACCACCTGCACCGCGTGCCCTGG + Exonic
1175959597 20:62628798-62628820 TCCATCTTCCCCGAGTGCCCTGG + Intergenic
1176550433 21:8218678-8218700 TCCACGCGCCCCGCGCGCGCGGG + Intergenic
1176569362 21:8401717-8401739 TCCACGCGCCCCGCGCGCGCGGG + Intergenic
1176577275 21:8445948-8445970 TCCACGCGCCCCGCGCGCGCGGG + Intergenic
1180083426 21:45497062-45497084 TCCAGCCGCCCCGGGCCTCCAGG + Exonic
1183720187 22:39557900-39557922 GCCCGCCGCCCCCCGCGCCCCGG + Intergenic
1184712773 22:46262912-46262934 TGCGGCTGCCGCGCTCGCCCGGG - Exonic
1185267094 22:49910066-49910088 TCCTGCTGGCCCTCGCGGCCTGG - Exonic
1203255329 22_KI270733v1_random:135017-135039 TCCACGCGCCCCGCGCGCGCGGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950656510 3:14440301-14440323 GCCAGCTGCCCCAGGCACCCTGG - Intronic
951555386 3:23916526-23916548 TCCAGCAGGCCCCAGCGCCCAGG - Exonic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953410078 3:42685814-42685836 TGCAGCTCGCCCGCGCGCTCCGG - Exonic
954305675 3:49724108-49724130 GCCAGCTGACCCGCGGGTCCCGG - Intergenic
954386417 3:50246349-50246371 TCCGGCTGCCGGGCGCCCCCTGG + Intronic
954437305 3:50503086-50503108 TCCGGCTGCCCGCTGCGCCCGGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961458191 3:127034481-127034503 TCCAGCTGCCAACCGGGCCCCGG - Exonic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
963040452 3:141066195-141066217 TCCAGCCGCGCCGGCCGCCCGGG - Exonic
963081846 3:141402241-141402263 ACCCGCAGCCCCGCGGGCCCGGG - Intronic
966076051 3:175937471-175937493 GCCAGCTGCCCTGCCAGCCCCGG + Intergenic
966787852 3:183636469-183636491 GCCCGCTCCCCCGCCCGCCCCGG - Intronic
968514911 4:1011844-1011866 TCCCGCCGCCCCGCGCCCCCGGG - Intronic
968583872 4:1406988-1407010 GCTCGCTGGCCCGCGCGCCCTGG - Intergenic
968593732 4:1472206-1472228 TCCGGCTGCCCCGCGGGACACGG - Intergenic
968701368 4:2059630-2059652 CCCCGCTGCCCGCCGCGCCCGGG + Exonic
968817333 4:2828855-2828877 TCCAGGCGCCCCGTGCTCCCGGG + Intronic
969220382 4:5755060-5755082 TCCAGCTGCCTCCCTCACCCAGG + Intronic
972671490 4:41216534-41216556 TCCCGCTGCCGCGCTCACCCAGG + Intronic
979674653 4:123398280-123398302 TCCCGCGGCTCCGCGCGGCCGGG - Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981688602 4:147481545-147481567 GCCCGCCTCCCCGCGCGCCCTGG - Intronic
985212807 4:187613286-187613308 TCCTGCCGCCCCGCGGGCCCTGG - Intergenic
985535910 5:465654-465676 TCCAGCTGCTCCCAGCGCCGCGG + Intronic
985646272 5:1086094-1086116 TCCACCTGCCCCGGGTGCCGTGG - Intronic
985769356 5:1799414-1799436 CCCTGCTTCCCCACGCGCCCCGG + Intronic
986330234 5:6712528-6712550 TCCAGCTGCACCGAGCGGGCAGG - Intergenic
986336016 5:6756080-6756102 TTCAGCTGCCCAGTGCGCCGTGG + Exonic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997471674 5:134120723-134120745 TCCAGCTGCCTTGCCAGCCCTGG + Intronic
999291177 5:150427558-150427580 TCCACCTGCCCGGCTCACCCAGG - Intergenic
1001773413 5:174312020-174312042 CCCCGCGCCCCCGCGCGCCCGGG - Intergenic
1002925861 6:1605320-1605342 TCCCGCCGCACCGCGCACCCTGG + Intergenic
1003948772 6:11098673-11098695 TCCACTTGCCCCGGGCTCCCAGG + Intronic
1005842530 6:29752995-29753017 TCCAGCTGCTCCGCCACCCCAGG + Intergenic
1006136686 6:31900354-31900376 CCCGGCTGCCCCCCGCCCCCAGG + Exonic
1007094800 6:39206558-39206580 CCCAGCTGCCCCTCGCGTGCTGG + Intronic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1012912897 6:105137229-105137251 GCCCGCCGCCCCGCGCCCCCCGG + Intergenic
1013225560 6:108117762-108117784 CGCCGCTGCCCCGCGCGGCCGGG - Intronic
1015904993 6:138107552-138107574 ACCAGCGGCCCCGCCCGCCCCGG - Intergenic
1020097720 7:5377852-5377874 TCCAGCTGCCCCTCACCCCCAGG + Intronic
1022112359 7:27239543-27239565 TCCAGCTGACCCGCGCGTCTGGG + Intergenic
1024811630 7:53219133-53219155 CCCAGCTGCCCTGAGCGCCTGGG - Intergenic
1026891257 7:73984078-73984100 GCCAGCTGCCCCGGGGGCCACGG - Intergenic
1029453624 7:100656154-100656176 CCCAGACGCCCCGCGCGCACAGG - Intronic
1031886998 7:127253408-127253430 TCCGGCTGCCTGGCGAGCCCGGG + Intergenic
1032525771 7:132577342-132577364 TCCAGCTGCCTGGCGCTCTCTGG + Intronic
1034446284 7:151115715-151115737 GCGAGCTGCCGCGCGCGTCCGGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034781933 7:153888481-153888503 CCCCGCTGACCCGCGCGGCCTGG + Intronic
1035048769 7:155986162-155986184 TCCAGCTGCCCAGCCAGGCCAGG + Intergenic
1035320916 7:158028786-158028808 TGCAGCTGCCCCGCCCTCCTGGG - Intronic
1036562248 8:9906901-9906923 TCCATCTGGCCCGGGCGCGCTGG - Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1038644730 8:29352081-29352103 TCGGGCTTCCACGCGCGCCCCGG - Intergenic
1039454205 8:37696987-37697009 GCCAGCTGCCGCGCCCGGCCCGG + Intronic
1039455187 8:37701127-37701149 CCCATTGGCCCCGCGCGCCCAGG - Intergenic
1041449884 8:57994950-57994972 TGCAGCTTCCCCGCCCGGCCCGG + Intronic
1043479253 8:80636658-80636680 TCCAGTTGACCCGTGTGCCCAGG + Exonic
1045468395 8:102489676-102489698 TCCACCTGCCTCCCGGGCCCAGG - Intergenic
1046962346 8:120124879-120124901 TCCGGCTGCCGCGCGCACCTGGG + Intronic
1049177997 8:141206005-141206027 TCCCGCCGCCCTCCGCGCCCTGG + Intergenic
1049223082 8:141436733-141436755 TCCCTGTGCCCTGCGCGCCCAGG + Intergenic
1049352455 8:142171459-142171481 ACCAGCTGCCCCCCAGGCCCTGG - Intergenic
1049566996 8:143345481-143345503 TCCTGCTGCCACGCGCGGCTGGG + Intronic
1050287533 9:4118403-4118425 TGCAGCTGCCGCGCACGCCCAGG + Exonic
1053123623 9:35562903-35562925 TCCAGCTGCCCCTCCGGCTCTGG + Exonic
1057490575 9:95516735-95516757 TCCGGCGGCCCAGCGCGCCGGGG - Intronic
1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG + Intronic
1059282534 9:113147376-113147398 TCCAGCTGCCCGGGACTCCCAGG - Intergenic
1060481225 9:124017838-124017860 TCCCGCAGCCCCTCGGGCCCGGG + Intronic
1060811591 9:126613793-126613815 TCCCGCCCCCCCGCGCGCCCCGG - Intergenic
1061158946 9:128882333-128882355 CCCAGATGCCCCGGGCGCCCCGG - Intronic
1061208616 9:129178133-129178155 TACCCCTGCCCGGCGCGCCCCGG - Exonic
1061509233 9:131050261-131050283 TCCAGCTGCTCAGGGTGCCCCGG - Intronic
1062084642 9:134642306-134642328 TCCCGCAGCCCCGCGCCCCGGGG - Intronic
1062162466 9:135087822-135087844 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062282280 9:135757387-135757409 CCCAGCTGCACCCCCCGCCCCGG - Intronic
1062370996 9:136238614-136238636 CCCAGCTGCCACGCGCGGCCTGG + Intronic
1062406647 9:136399942-136399964 GCCAGAATCCCCGCGCGCCCAGG + Intergenic
1062621127 9:137423081-137423103 CCCACCTGGCCCGCGCGGCCCGG + Intronic
1203740045 Un_GL000216v2:171040-171062 TCCACATGCCCTGCGCGCCTGGG + Intergenic
1203471727 Un_GL000220v1:118154-118176 TCCACGCGCCCCGCGCGCGCGGG + Intergenic
1187419561 X:19122580-19122602 TCCAGCTGCCCAGCGCGGCGTGG + Intronic
1189332479 X:40152377-40152399 TGGAGCTTCCCAGCGCGCCCTGG + Intronic
1192438082 X:71154908-71154930 TTCTGCTGCCCCCCGCCCCCAGG + Intronic
1195614281 X:106900510-106900532 TCTAGCTGCCCAGCTCACCCTGG - Exonic
1199976520 X:152897873-152897895 TCCAGCAGCCCCGCGGGGCGGGG + Intergenic