ID: 1008092842

View in Genome Browser
Species Human (GRCh38)
Location 6:47309707-47309729
Sequence CGCCTGGGCGGCCGCGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008092842_1008092851 13 Left 1008092842 6:47309707-47309729 CCAGCGGCGCGGCCGCCCAGGCG 0: 1
1: 0
2: 3
3: 27
4: 257
Right 1008092851 6:47309743-47309765 GCGACTGCAGCCCGCGTCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 78
1008092842_1008092852 14 Left 1008092842 6:47309707-47309729 CCAGCGGCGCGGCCGCCCAGGCG 0: 1
1: 0
2: 3
3: 27
4: 257
Right 1008092852 6:47309744-47309766 CGACTGCAGCCCGCGTCTCCGGG 0: 1
1: 0
2: 0
3: 18
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008092842 Original CRISPR CGCCTGGGCGGCCGCGCCGC TGG (reversed) Exonic