ID: 1008092842 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:47309707-47309729 |
| Sequence | CGCCTGGGCGGCCGCGCCGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 288 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 27, 4: 257} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008092842_1008092851 | 13 | Left | 1008092842 | 6:47309707-47309729 | CCAGCGGCGCGGCCGCCCAGGCG | 0: 1 1: 0 2: 3 3: 27 4: 257 |
||
| Right | 1008092851 | 6:47309743-47309765 | GCGACTGCAGCCCGCGTCTCCGG | 0: 1 1: 0 2: 0 3: 3 4: 78 |
||||
| 1008092842_1008092852 | 14 | Left | 1008092842 | 6:47309707-47309729 | CCAGCGGCGCGGCCGCCCAGGCG | 0: 1 1: 0 2: 3 3: 27 4: 257 |
||
| Right | 1008092852 | 6:47309744-47309766 | CGACTGCAGCCCGCGTCTCCGGG | 0: 1 1: 0 2: 0 3: 18 4: 589 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008092842 | Original CRISPR | CGCCTGGGCGGCCGCGCCGC TGG (reversed) | Exonic | ||