ID: 1008101147

View in Genome Browser
Species Human (GRCh38)
Location 6:47392495-47392517
Sequence AGGGAGACAACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008101147_1008101155 24 Left 1008101147 6:47392495-47392517 CCCACAGTCACTGTTGTCTCCCT No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008101147 Original CRISPR AGGGAGACAACAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr