ID: 1008101155

View in Genome Browser
Species Human (GRCh38)
Location 6:47392542-47392564
Sequence CAGCACCACAGAGCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008101152_1008101155 0 Left 1008101152 6:47392519-47392541 CCCCAAGCACATAGAATCTCTCT No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data
1008101151_1008101155 1 Left 1008101151 6:47392518-47392540 CCCCCAAGCACATAGAATCTCTC No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data
1008101150_1008101155 4 Left 1008101150 6:47392515-47392537 CCTCCCCCAAGCACATAGAATCT No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data
1008101154_1008101155 -2 Left 1008101154 6:47392521-47392543 CCAAGCACATAGAATCTCTCTCA No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data
1008101148_1008101155 23 Left 1008101148 6:47392496-47392518 CCACAGTCACTGTTGTCTCCCTC No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data
1008101153_1008101155 -1 Left 1008101153 6:47392520-47392542 CCCAAGCACATAGAATCTCTCTC No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data
1008101149_1008101155 5 Left 1008101149 6:47392514-47392536 CCCTCCCCCAAGCACATAGAATC No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data
1008101147_1008101155 24 Left 1008101147 6:47392495-47392517 CCCACAGTCACTGTTGTCTCCCT No data
Right 1008101155 6:47392542-47392564 CAGCACCACAGAGCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008101155 Original CRISPR CAGCACCACAGAGCTGCTTC TGG Intergenic
No off target data available for this crispr