ID: 1008105009

View in Genome Browser
Species Human (GRCh38)
Location 6:47431662-47431684
Sequence CTCACTGCACAAAGTAATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008105009_1008105012 6 Left 1008105009 6:47431662-47431684 CCGAGATTACTTTGTGCAGTGAG No data
Right 1008105012 6:47431691-47431713 TGACCTTCATGTATTTTGGCTGG No data
1008105009_1008105011 2 Left 1008105009 6:47431662-47431684 CCGAGATTACTTTGTGCAGTGAG No data
Right 1008105011 6:47431687-47431709 GACTTGACCTTCATGTATTTTGG No data
1008105009_1008105014 9 Left 1008105009 6:47431662-47431684 CCGAGATTACTTTGTGCAGTGAG No data
Right 1008105014 6:47431694-47431716 CCTTCATGTATTTTGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008105009 Original CRISPR CTCACTGCACAAAGTAATCT CGG (reversed) Intergenic
No off target data available for this crispr