ID: 1008106135

View in Genome Browser
Species Human (GRCh38)
Location 6:47442768-47442790
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008106135_1008106137 -10 Left 1008106135 6:47442768-47442790 CCACCTAGCATGTTTAAACACCC No data
Right 1008106137 6:47442781-47442803 TTAAACACCCTTCCTATGTTTGG No data
1008106135_1008106142 23 Left 1008106135 6:47442768-47442790 CCACCTAGCATGTTTAAACACCC No data
Right 1008106142 6:47442814-47442836 ATATGATGAGCCCTTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008106135 Original CRISPR GGGTGTTTAAACATGCTAGG TGG (reversed) Intergenic