ID: 1008106142

View in Genome Browser
Species Human (GRCh38)
Location 6:47442814-47442836
Sequence ATATGATGAGCCCTTTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008106135_1008106142 23 Left 1008106135 6:47442768-47442790 CCACCTAGCATGTTTAAACACCC No data
Right 1008106142 6:47442814-47442836 ATATGATGAGCCCTTTCTCAAGG No data
1008106136_1008106142 20 Left 1008106136 6:47442771-47442793 CCTAGCATGTTTAAACACCCTTC No data
Right 1008106142 6:47442814-47442836 ATATGATGAGCCCTTTCTCAAGG No data
1008106138_1008106142 3 Left 1008106138 6:47442788-47442810 CCCTTCCTATGTTTGGAGAATTC No data
Right 1008106142 6:47442814-47442836 ATATGATGAGCCCTTTCTCAAGG No data
1008106139_1008106142 2 Left 1008106139 6:47442789-47442811 CCTTCCTATGTTTGGAGAATTCC No data
Right 1008106142 6:47442814-47442836 ATATGATGAGCCCTTTCTCAAGG No data
1008106140_1008106142 -2 Left 1008106140 6:47442793-47442815 CCTATGTTTGGAGAATTCCGCAT No data
Right 1008106142 6:47442814-47442836 ATATGATGAGCCCTTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008106142 Original CRISPR ATATGATGAGCCCTTTCTCA AGG Intergenic