ID: 1008113115

View in Genome Browser
Species Human (GRCh38)
Location 6:47515114-47515136
Sequence GTGCATTGTAGGTCTGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008113115 Original CRISPR GTGCATTGTAGGTCTGGCAA AGG Intronic
903015349 1:20358049-20358071 GTCCAGTGTAAGTCTGCCAAAGG - Intergenic
904748793 1:32727822-32727844 GTGCATAGTAAGTCAGGTAACGG + Intergenic
904883146 1:33715574-33715596 CTGCATTGGAGGCCTGGCAGGGG + Intronic
905274401 1:36807635-36807657 GTGCTTCCTAGATCTGGCAAGGG + Intronic
906649484 1:47502734-47502756 GGGCATTGGGGGTCTGGAAATGG + Intergenic
919375578 1:196790142-196790164 GTTCATAGTAGGGCTGGCATTGG - Exonic
919384769 1:196907413-196907435 GTTCATAGTAGGACTGGCACTGG - Exonic
919385278 1:196915053-196915075 GTTCATAGTAGGACTGGCATTGG - Exonic
919794494 1:201313156-201313178 TTCCATTGTAGATCTGGCCAGGG - Exonic
1069899295 10:71697777-71697799 GGGTTTTGTAGGTCTGGCAAGGG - Intronic
1070172249 10:73941511-73941533 GAGCCTTTTGGGTCTGGCAAAGG + Intergenic
1071242736 10:83726306-83726328 GTGCATTGTGGGTCTGATATTGG - Intergenic
1075311243 10:121415510-121415532 GTACACTATAAGTCTGGCAAGGG + Intergenic
1078399187 11:11009259-11009281 GGGCCTTGCAGGTCTTGCAAAGG + Intergenic
1082720370 11:56667853-56667875 GAGCATTGGAGGTCTGGCTGGGG - Intergenic
1083752117 11:64766548-64766570 GTGCATGCTTGCTCTGGCAAGGG - Intronic
1094171853 12:27501731-27501753 GTTCATGCTAGGTCTGGCATTGG - Intronic
1098003414 12:65969367-65969389 GCGAATTGTTGGTCTGGCAGTGG + Intergenic
1108784657 13:53881560-53881582 GTGCATGGTAGGTATAGCCATGG - Intergenic
1110405884 13:75150071-75150093 GTCAATTGTAGGTCTGGCTAGGG - Intergenic
1110549481 13:76796201-76796223 GCACATTGTAGGCCTGGGAATGG - Intergenic
1111438193 13:88240107-88240129 ATGCATTTGAGGTTTGGCAAAGG - Intergenic
1111547263 13:89756654-89756676 GTTGATTGTAGGGCTGGTAAAGG + Intergenic
1112394892 13:99020386-99020408 GTGCATTTTAGACCTGGGAAAGG + Intronic
1112825904 13:103392362-103392384 GTAGTTTGTAGGTGTGGCAATGG + Intergenic
1115242599 14:31264591-31264613 AAGCATTATAGTTCTGGCAAGGG + Intergenic
1117080891 14:52150879-52150901 GAGCATTGTAAGACTGGAAAGGG - Intergenic
1119190299 14:72677187-72677209 GTACATTTTTAGTCTGGCAATGG + Intronic
1119965626 14:78912479-78912501 GTTCATTGTAGGTCTGCTATAGG - Intronic
1121445436 14:93975675-93975697 GTGAAATGTGGCTCTGGCAAAGG - Intronic
1122964745 14:105117445-105117467 GTGCAGTGTGGGTCTGGTGATGG - Intergenic
1128650867 15:69412600-69412622 GTGCAATGTAGGGGTGGAAAAGG + Intergenic
1129888517 15:79055668-79055690 GGGCATTGTAGGTCAGAGAAGGG - Intronic
1131601796 15:93856795-93856817 GTGCATTGTATGATTGGGAAAGG + Intergenic
1138732689 16:59212786-59212808 GTGGATTGCATGTCTGGGAAGGG + Intergenic
1149252168 17:54783107-54783129 GTGCATTGAATTTGTGGCAAGGG - Intergenic
1152988490 18:341049-341071 GTGCAATGTGGGTCAGGCAGGGG - Intronic
1156673151 18:39495049-39495071 GTGCATTTTAAGTATGGCAGTGG - Intergenic
1157591725 18:48840253-48840275 GTGGATTGGAGGTCTGTGAAGGG + Intronic
1161938170 19:7384993-7385015 GTGCACTGAAGATTTGGCAAAGG - Intronic
1164629072 19:29749286-29749308 CTGCATTGTAAGTCTGGCCGTGG + Intergenic
1165078882 19:33296567-33296589 GTGCACTGTGGGCCTTGCAAGGG + Intergenic
1165214315 19:34258908-34258930 ATGAATTTTAGGTCTGGCACAGG + Intronic
926472855 2:13282758-13282780 GTGAATTGTTGGTCTGGAGAAGG + Intergenic
928917631 2:36490136-36490158 GTGCATTTGAGGTCTGTGAAAGG + Intronic
935963223 2:108447684-108447706 GTGCAATGGAGGGCTGGCGAGGG + Intergenic
936050806 2:109222527-109222549 GTGCATTGTTGGAGGGGCAAGGG + Intronic
941914831 2:170804643-170804665 GTGCATTGGAGGTGAGGAAAAGG + Intergenic
943830414 2:192453241-192453263 GTGCATGTTTGGTCTAGCAATGG - Intergenic
944446411 2:199795136-199795158 GTGCCTTGTATGTCAGGCATTGG - Intronic
1181030055 22:20145321-20145343 GTGCCGTGTAGGGCTGGCAGAGG - Intronic
1181858771 22:25801972-25801994 GTGAATTGTAGGCCTGCCATAGG - Intronic
1184740525 22:46426410-46426432 GTAGATTGAACGTCTGGCAAGGG + Intronic
950813603 3:15674444-15674466 GGGGAGAGTAGGTCTGGCAAGGG + Intronic
966719492 3:183047221-183047243 GTGGACAGTATGTCTGGCAAAGG - Intronic
967467140 3:189820630-189820652 GTGCATTGTACTTCTGTAAAAGG - Intronic
971340942 4:25768267-25768289 GTGCATTAGAAGTTTGGCAAAGG + Intronic
975456643 4:74598449-74598471 GTGCTTTGTGTGTCTGTCAATGG - Intergenic
978276346 4:106955420-106955442 GGGCATTGTAGGATTGGCAGAGG + Intronic
980585268 4:134805634-134805656 TTGGCTTGTAGGTCTGGCAGGGG + Intergenic
981603620 4:146520212-146520234 GTGCATTGCAGATCATGCAAAGG + Intronic
982232040 4:153218168-153218190 GCATATTGTATGTCTGGCAATGG + Intronic
996391674 5:122969320-122969342 GTGAATTCTAGTTGTGGCAATGG + Intronic
1000204111 5:159041065-159041087 GTGGATTGTAAGTCTGCCAAGGG - Intronic
1005729227 6:28680685-28680707 GCCCATTGTAGGTATTGCAAAGG - Intergenic
1008113115 6:47515114-47515136 GTGCATTGTAGGTCTGGCAAAGG + Intronic
1019026710 6:168971614-168971636 GTGCACTGTACGTCAAGCAAAGG - Intergenic
1021651569 7:22838142-22838164 GTGTATTGTAGGTGTTGGAAAGG - Intergenic
1025723928 7:64041216-64041238 GTGCATTGTATTTATGACAATGG + Intronic
1025753042 7:64310491-64310513 GTGCATTGTATTTATGACAATGG + Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032756770 7:134898398-134898420 GTTCTTTGTAGATCTGGGAAAGG + Intronic
1033565250 7:142571828-142571850 GTGCTTTGTAGGGCTGGTAATGG - Intergenic
1040093677 8:43421913-43421935 GTGCATTGTATGTCTCAGAATGG - Intergenic
1045793396 8:106013299-106013321 TAGCATTGTAGTTCTGTCAATGG + Intergenic
1046481894 8:114831436-114831458 GTGCATACTAGGTATGCCAATGG - Intergenic
1046481951 8:114832495-114832517 GTGCATACTAGGTATGCCAATGG - Intergenic
1048030167 8:130623607-130623629 GTCCATTTTAGGTCTGGCTATGG + Intergenic
1048878034 8:138852061-138852083 ATGCATGGGAGGTCTGGGAAAGG + Intronic
1187291234 X:17955368-17955390 GTGAAGTCTAGGACTGGCAATGG - Intergenic
1196751403 X:119120934-119120956 TGACATTGTATGTCTGGCAATGG - Intronic
1197949354 X:131877285-131877307 GTGCATAGTAGCCCTGGTAAAGG + Intergenic
1198389500 X:136159982-136160004 GTGCATGGAAGTTCTGGCATTGG - Intronic