ID: 1008115603

View in Genome Browser
Species Human (GRCh38)
Location 6:47545867-47545889
Sequence CTCTGTCAGAGGGAAGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 465}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008115603_1008115611 15 Left 1008115603 6:47545867-47545889 CCCTACACTTCCCTCTGACAGAG 0: 1
1: 1
2: 1
3: 39
4: 465
Right 1008115611 6:47545905-47545927 AGGAATCAGAAAACCAACTCTGG 0: 8
1: 145
2: 282
3: 527
4: 835
1008115603_1008115607 -5 Left 1008115603 6:47545867-47545889 CCCTACACTTCCCTCTGACAGAG 0: 1
1: 1
2: 1
3: 39
4: 465
Right 1008115607 6:47545885-47545907 CAGAGCCTACCCAAATGAGAAGG 0: 207
1: 239
2: 343
3: 341
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008115603 Original CRISPR CTCTGTCAGAGGGAAGTGTA GGG (reversed) Intronic
903739891 1:25552633-25552655 CTCTGGCAGGTGGAAGTGTGAGG + Intronic
904383256 1:30125431-30125453 CGCTGTGAAAGGGGAGTGTAAGG + Intergenic
904581433 1:31546987-31547009 GTGAGTCAGAGGGAAGTGTAAGG + Intergenic
906379611 1:45324097-45324119 CTGTGTCAGGGAGAAGTTTATGG - Intergenic
906877078 1:49551425-49551447 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
907349234 1:53812119-53812141 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
907462645 1:54614418-54614440 CTGTGTTAGAAGGAAGTGTAGGG + Intronic
908660580 1:66431366-66431388 CTATGTCAGAGGGAAGAGCTGGG + Intergenic
908803666 1:67907530-67907552 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
911317958 1:96377153-96377175 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
911678819 1:100691173-100691195 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
912302415 1:108531815-108531837 CTCTGTGAGTGGGAAGAGCAGGG - Intergenic
913143217 1:115962427-115962449 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
913234034 1:116765096-116765118 CTCTGTTCGAGGGATGTGTTAGG + Intronic
913337207 1:117719284-117719306 CTATGTCAGAGGAAAGTCTGGGG - Intergenic
913339648 1:117746477-117746499 CTCTGTCAGAGGGAAGGTCTTGG + Intergenic
913418098 1:118635066-118635088 CTATGTCAGAGGGAAGATAAGGG - Intergenic
913552180 1:119926357-119926379 CTCTTTCAGAGGAAAGTGCTTGG - Intronic
916225792 1:162488544-162488566 CTCAGTCAGAGGGTAGTGGCAGG + Intergenic
916263849 1:162869719-162869741 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
917057796 1:171003371-171003393 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
917212441 1:172644373-172644395 CTCTGTCAGAGGGCAGCATCAGG + Intergenic
917319069 1:173759735-173759757 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
918873585 1:190009055-190009077 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
919277988 1:195445519-195445541 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
919549406 1:198966036-198966058 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
920318409 1:205097130-205097152 CTCTATCAGGGAGAAGTGAAAGG + Intronic
920726882 1:208444868-208444890 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
922395920 1:225201493-225201515 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
922658053 1:227402828-227402850 CTCTGTCAGAGGGAAGGGCTAGG - Intergenic
922927284 1:229360562-229360584 CTCTGTCAGAGGGAAGGTCCGGG + Intergenic
923648321 1:235846384-235846406 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
923661715 1:235962763-235962785 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
924321323 1:242854280-242854302 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1064773185 10:18746832-18746854 CTCTGTCAGAGGGGAAAGGAGGG - Intergenic
1065462440 10:25982806-25982828 CTATGTCAGAGGGAAGATCAGGG - Intronic
1066199061 10:33128183-33128205 ATCTGTCAGAAGGAAGGGGAAGG - Intergenic
1067977280 10:51041057-51041079 CTCTGCTTGAGGGAAGGGTAAGG - Intronic
1068096525 10:52498913-52498935 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1068360724 10:55973006-55973028 CTCTTTCAGAGGAAATTGTTGGG - Intergenic
1068480861 10:57586286-57586308 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1069825291 10:71251227-71251249 CCCTGTCAGAGGTCAGGGTAAGG + Intronic
1071843618 10:89498988-89499010 CTCTGTCAGAGGGAAGATCTAGG - Intronic
1071870468 10:89789135-89789157 CTATGTCAGAGGGAAGATCAGGG + Intergenic
1071910730 10:90229864-90229886 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1073960341 10:108919453-108919475 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1074120067 10:110487529-110487551 CTCTGGCAGAGGGAGGGGGAAGG - Intergenic
1074985729 10:118658164-118658186 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1075454851 10:122578504-122578526 CTCTCTCAGAGAGAGGTGGAAGG + Intronic
1075946893 10:126440902-126440924 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1075982664 10:126755012-126755034 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1076407517 10:130222555-130222577 CTCTGCCAGGGGCAAGGGTAGGG + Intergenic
1076666203 10:132094387-132094409 CTCTGTCAGAGGGAAAGTTTAGG + Intergenic
1078288684 11:9983939-9983961 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1080245294 11:30173162-30173184 CTCTGAAAGCAGGAAGTGTAGGG - Intergenic
1080324206 11:31050843-31050865 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1080890908 11:36408520-36408542 CTCTGGCAGATGGAAATTTAGGG - Intronic
1083175430 11:60946880-60946902 CTCTGTAGGAGGGAGGGGTATGG - Intronic
1084368030 11:68716439-68716461 TTCTGTGAGGGGGAAGTGAATGG + Intronic
1085186140 11:74577565-74577587 CTCAGTGAGAGAGATGTGTAAGG + Intronic
1085570130 11:77551712-77551734 CTCTGTAAGAGGAAATTGTTGGG - Intronic
1085734712 11:79029442-79029464 TTGTGTCTGAGGGCAGTGTATGG + Intronic
1085747912 11:79130248-79130270 CTCTGTCAGAGGGAAGATCTTGG - Intronic
1086889962 11:92246113-92246135 CTCTGCCAGATGGCAGTGGATGG + Intergenic
1087399947 11:97652241-97652263 CTCTGTCTCAGGGAGGTGTAAGG + Intergenic
1087468942 11:98546522-98546544 CTCTGTCAGAGGGAAGTTCTAGG - Intergenic
1088477133 11:110252603-110252625 CTTTGACAGAGGGAAATGCAAGG + Intronic
1090559439 11:127914966-127914988 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1090661612 11:128886290-128886312 CTCTATCAGAGGGAAGCGGAGGG + Intergenic
1090757395 11:129804359-129804381 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1091210438 11:133853938-133853960 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1092114047 12:5985766-5985788 CTCTGTCAGAGGGCTGGGTCAGG - Intronic
1092217443 12:6693231-6693253 CTCTCTGAGAGGGCAGAGTAGGG + Intergenic
1092303794 12:7279192-7279214 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1092756533 12:11768723-11768745 CTCTTTCAGAGGCAAGGGCAAGG - Intronic
1093001955 12:14007243-14007265 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1093010613 12:14102524-14102546 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1093045475 12:14439192-14439214 TTCTGTCATAAGTAAGTGTATGG + Intronic
1093055027 12:14547392-14547414 CTCTGCCACACAGAAGTGTAGGG - Intronic
1093104973 12:15075258-15075280 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1093409180 12:18844722-18844744 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1093488641 12:19680806-19680828 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1093995045 12:25631660-25631682 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1094263366 12:28527233-28527255 CTCTGTCAGAAGAAGGTCTAGGG + Intronic
1094447270 12:30545653-30545675 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1094721933 12:33074807-33074829 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1096888505 12:54743123-54743145 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1097038324 12:56138601-56138623 CTCTTTCTGAGGGTAGTGCAGGG + Intronic
1097760641 12:63460039-63460061 CTCTGTCAGAGGGAAGGTCTGGG - Intergenic
1099687349 12:85907528-85907550 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1100203505 12:92324879-92324901 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1103130144 12:118461016-118461038 CATTGTCAGAGGGAAGAGTATGG + Intergenic
1103761016 12:123250487-123250509 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1105908346 13:24835683-24835705 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1106392148 13:29345782-29345804 CTATGTCAGAGGGAAGATTTGGG + Intronic
1107184915 13:37506356-37506378 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1107755907 13:43622375-43622397 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1109047813 13:57436624-57436646 CTCTGTCAGAGGGAAGATCTAGG + Intergenic
1109213492 13:59562506-59562528 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1109508324 13:63336394-63336416 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1109578672 13:64296289-64296311 CTTTGTCAGAAGGCAGTGGAGGG + Intergenic
1110661122 13:78060427-78060449 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1110748174 13:79080092-79080114 CTCTGTCAGAGGGATGTTCTAGG - Intergenic
1110804309 13:79736666-79736688 CTCGGTCCTAGGGAAGTGCAGGG + Intergenic
1111022583 13:82472463-82472485 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1112035264 13:95491794-95491816 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1112087079 13:96042377-96042399 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1112738175 13:102444006-102444028 CTCTGTCAGAGGGAAGTTCTAGG - Intergenic
1112945406 13:104920841-104920863 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1113879028 13:113612339-113612361 CCCTGTCAGAGGGAGGTGGTGGG + Intronic
1114771108 14:25429612-25429634 CTCTGTAAGAGGAAATTGTTGGG + Intergenic
1115350553 14:32390478-32390500 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1115527145 14:34292870-34292892 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1115958612 14:38809611-38809633 CTCTGTCAGATGGAAGGTTTAGG - Intergenic
1116088915 14:40278845-40278867 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1116497742 14:45582977-45582999 CTCTGCCTGAGGAAAGTGGAGGG - Intergenic
1117112854 14:52476190-52476212 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1117290405 14:54326668-54326690 CCATGTCAGAGGGAAGAGTTAGG - Intergenic
1117510697 14:56448267-56448289 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1117591301 14:57270730-57270752 ATCTGTCAGTGGGAAGGGAACGG - Intronic
1117639920 14:57786775-57786797 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1118165680 14:63333134-63333156 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1119098554 14:71856938-71856960 CTCTGTCAGAGAGAAGGTTTAGG - Intergenic
1120543203 14:85777284-85777306 CTCTGTCTGAGGGAAGTAGAGGG - Intergenic
1120545689 14:85808808-85808830 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1123948075 15:25248512-25248534 CTCTGTGTGTGGGAGGTGTAGGG + Intergenic
1124380817 15:29163172-29163194 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1124386999 15:29217875-29217897 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1124674043 15:31668779-31668801 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1125055845 15:35358512-35358534 CTCTGTCAGAGGGAAGTTCTAGG + Intronic
1125274894 15:37979353-37979375 TTCTGTCCGAGGGCAGTGCAGGG + Intergenic
1126469093 15:48988016-48988038 CTATGTCACAGTGAAATGTAGGG - Intergenic
1126572808 15:50169540-50169562 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1127882380 15:63169717-63169739 TTGTGTCATAGGGAAGTGGATGG - Intergenic
1128238821 15:66085687-66085709 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1128415109 15:67437418-67437440 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1129814201 15:78537800-78537822 CTCTGTAAGAAGCAAGTGTTCGG - Intergenic
1130779670 15:87022177-87022199 CTCTGTCAGAGGGAAGGTGTAGG - Intronic
1131817129 15:96233610-96233632 CTGTCTCAGAGGGCAGTCTACGG - Intergenic
1132033480 15:98458478-98458500 CTCTGTCAGAGGGAAGGGCTAGG - Intronic
1133739354 16:8639946-8639968 CTCAGGCAGAGGGAAGAGCAAGG - Intronic
1133953099 16:10414749-10414771 CTCTGTCAGAGGAAAGGTTTAGG + Intronic
1134036446 16:11034807-11034829 TTCTGTCAGAGGGAAATGACTGG + Intronic
1138797875 16:59992648-59992670 CTCTGTCAGAGGGAAGCTCTAGG + Intergenic
1141315222 16:82956247-82956269 ATCTGTCAGAGAGAAGTAGAAGG - Intronic
1144139580 17:12336012-12336034 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1145714969 17:27010515-27010537 CTCTGTCAGAGAGAACTGGAGGG - Intergenic
1146751363 17:35384378-35384400 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1149319457 17:55469267-55469289 CTCTGTCAGAGGCAATTTTGGGG - Intergenic
1151829340 17:76540484-76540506 CTCTGTGGGAGGCAAGAGTAGGG - Exonic
1153069398 18:1088679-1088701 CTCTGTCAGAGGGAAGGCCTAGG + Intergenic
1153400571 18:4679618-4679640 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1153965842 18:10181574-10181596 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1156011285 18:32500833-32500855 CTCTGTCAGAGGGAAGATCCAGG + Intergenic
1156953889 18:42937902-42937924 CTCTTTGAGAGGCAAATGTAAGG + Intronic
1158002707 18:52637180-52637202 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1158829852 18:61264676-61264698 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1160219660 18:76965516-76965538 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1160350103 18:78170982-78171004 CTCCTTCAGAAGGAAGTGCAGGG - Intergenic
1161570038 19:5025488-5025510 CTCTGGCTGTGGGAAGTGGATGG - Intronic
1161741298 19:6022633-6022655 CTCTTCCAGAGGGAAGGGGACGG - Intronic
1163179342 19:15587946-15587968 CTAAGTCAGAGGGCAGGGTATGG - Intergenic
1165323674 19:35101371-35101393 ATCTGTAAAAGGGAAGTGAATGG + Intergenic
1167997871 19:53421189-53421211 CTCTGTCATAAGTAAGTTTAAGG - Intronic
1168581344 19:57558234-57558256 CTCAGACAAAGGGAAGTGCAAGG + Intronic
925127386 2:1469335-1469357 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
926560273 2:14409013-14409035 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
926647073 2:15301699-15301721 CTCTGACAGAGGTAAGTACAGGG + Intronic
926915912 2:17892563-17892585 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
927328250 2:21831963-21831985 CTCTGTCAGAGGGAAGATCTTGG + Intergenic
927456201 2:23251271-23251293 CTCTTTCACAGGGAAGTGTGTGG - Intergenic
928443140 2:31310689-31310711 CTATGTCAGAGGGAAGATTTAGG + Intergenic
929032344 2:37660880-37660902 CCCTGTCAAAGGGAAATGGAAGG + Intronic
930448637 2:51506102-51506124 CTATGTCAGAGGGAAGTTCTGGG - Intergenic
931525126 2:63144885-63144907 CTCTATCAGAGGGAAGGTTTAGG + Intronic
931993112 2:67810334-67810356 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
932100565 2:68896061-68896083 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
932441174 2:71736601-71736623 TTCTGCCAGAAGGAAGTGTCAGG + Intergenic
932954553 2:76336791-76336813 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
933100821 2:78254585-78254607 GTCTGTCAGAGGGTAGTGGGTGG - Intergenic
933121448 2:78542512-78542534 CTCTGTCAGAGGGAAGGTCAAGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933976697 2:87517773-87517795 CTCTGTCAGAGACAAGGGCAGGG + Intergenic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934177653 2:89590974-89590996 CTCTGTCAGAGGAAAGTTCTAGG + Intergenic
934287952 2:91665275-91665297 CTCTGTCAGAGGAAAGTTCTAGG + Intergenic
934927926 2:98394759-98394781 CTCTGCCAAAGGGAAGAGTTAGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936317120 2:111433031-111433053 CTCTGTCAGAGACAAGGGCAGGG - Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937057942 2:118954928-118954950 TTCTGTTAGAGGGAAGTCTAGGG - Intronic
937529368 2:122809374-122809396 CTCTATCAGAGGGAAGTTCTAGG - Intergenic
937781889 2:125848307-125848329 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
937971978 2:127557531-127557553 CTATGTCAGAGGGAAGTTCTGGG + Intronic
938037992 2:128052651-128052673 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
938238407 2:129724288-129724310 TCCTGTGAGAGGGAACTGTATGG + Intergenic
938598168 2:132810901-132810923 CTCTGTCAGAGGGAAGGTACAGG + Intronic
939275587 2:139992876-139992898 CTCTGTCCCAGGGAAGGGCAGGG + Intergenic
940709302 2:157143455-157143477 CTCTGTCAGAGGGAAGGCCTAGG + Intergenic
940802305 2:158145968-158145990 CTCTGTCAGAGGGAAGGCCTAGG - Intergenic
941078469 2:161033075-161033097 CTCTGTCAAAGGAAAGGGAAAGG + Intergenic
941627523 2:167845609-167845631 CTCTGTCAGAGGGAAGATCTAGG - Intergenic
941631532 2:167890586-167890608 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
942154642 2:173115542-173115564 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
942470021 2:176250623-176250645 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
942866746 2:180685574-180685596 CCCTGTCGGAGGGCAGTCTATGG + Intergenic
943891205 2:193289698-193289720 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
943937199 2:193934954-193934976 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
944404905 2:199373149-199373171 CCCTGTCTGAGGGAAGAGGAGGG + Intronic
945132027 2:206583988-206584010 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
945482496 2:210360323-210360345 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
945825788 2:214718288-214718310 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
945989742 2:216385493-216385515 CTCTGTCAGTGTGAGGAGTAAGG - Intergenic
946899195 2:224355912-224355934 CTCTGACAGAGGGATGTACAGGG + Intergenic
946936173 2:224723088-224723110 GTCTGTGAGAGGGATGTTTACGG + Intergenic
948710909 2:239825037-239825059 CGCTGTCAGAGGGGAGGGTTGGG + Intergenic
1170245665 20:14219656-14219678 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1170375788 20:15699206-15699228 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1170720937 20:18878766-18878788 CTCTGTCAGAGGGAAGATCTAGG + Intergenic
1171165684 20:22968056-22968078 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1171378551 20:24714285-24714307 CTATGTCAGAGGGAAGATTTGGG + Intergenic
1172851338 20:37968550-37968572 CTATGTCAGAGGGACGATTAGGG + Intergenic
1172872619 20:38145052-38145074 GGCTCTCAGAGGGAAGTGTCTGG + Intronic
1174497701 20:50959951-50959973 ATGTTTCAGAGGGATGTGTAGGG - Exonic
1175069165 20:56317085-56317107 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1177140612 21:17353629-17353651 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1177174348 21:17688662-17688684 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1177195491 21:17900317-17900339 CTCTGTCAGAGGGAAGATCTAGG + Intergenic
1177995258 21:28089431-28089453 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1178801773 21:35801927-35801949 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1178959133 21:37047874-37047896 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1179084109 21:38202611-38202633 CTCTGTCAGAGGGAAGGTCTGGG + Intronic
1182795176 22:32986589-32986611 GTCTGGCAGAGGGAAGGGTAGGG + Intronic
1183048278 22:35239882-35239904 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1183622408 22:38982210-38982232 CTCTGCCAGCGGGAAGGGTCCGG + Intronic
1184250252 22:43256068-43256090 CTCCGTCACAGGGACGTGAAGGG + Intronic
1184259634 22:43307204-43307226 CCATGTCAGAGGGAAGCCTAGGG + Intronic
949193205 3:1274752-1274774 ATCAGTCAGAGGAAAATGTATGG + Intronic
949814352 3:8041656-8041678 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
950592316 3:13947333-13947355 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
951183891 3:19689330-19689352 CTCTGTCAGAGGGAAGATCTGGG - Intergenic
953866505 3:46587586-46587608 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
955714117 3:61810704-61810726 CTCTGTCAAAGGCCATTGTAGGG - Intronic
955860010 3:63318887-63318909 CTCTGTCAGAGGGAAGATCTGGG + Intronic
956116685 3:65926381-65926403 CTCTGACAGAGGGAGGTGTAGGG - Intronic
956163110 3:66375259-66375281 CTCTGTAACACAGAAGTGTAAGG + Intronic
956950355 3:74274665-74274687 CTCTGTCAGAGGGAAGGTGTAGG - Intronic
957016314 3:75068938-75068960 CTCTGTCAGAGGGAAGGTTTGGG + Intergenic
957841689 3:85679196-85679218 CTCTGATAGAGGGAAGTGCCAGG + Intronic
957971792 3:87391263-87391285 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
958074660 3:88660572-88660594 CTTGCTCAGAGGGAAGTGAAGGG - Intergenic
958262898 3:91403608-91403630 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
958444780 3:94202395-94202417 CTATGTCAGAGGGAAGATTTAGG + Intergenic
958505701 3:94974149-94974171 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
959039569 3:101405443-101405465 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
959047056 3:101485621-101485643 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
959722211 3:109504998-109505020 CTTTGTCAGAGGGAAGTTCTAGG + Intergenic
959899145 3:111639991-111640013 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
960512763 3:118571122-118571144 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
960516632 3:118608840-118608862 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
960590837 3:119363943-119363965 CTCTGTGAGAGGGTTGTGAATGG - Intronic
961938037 3:130606282-130606304 CACTGTCATATGTAAGTGTAGGG - Intronic
962065926 3:131980821-131980843 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
962759065 3:138492422-138492444 CTCTGCCAGAGGAAAGGGGAAGG - Intergenic
964189079 3:153980923-153980945 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
964460954 3:156927234-156927256 CTCAGATAGAGTGAAGTGTATGG - Intronic
964601157 3:158503016-158503038 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
964772679 3:160240371-160240393 CTCTGTCAGAGGGAAGATCTGGG - Intronic
965052639 3:163670807-163670829 CTCTGTCAGAGGGAAGGTATAGG + Intergenic
965216795 3:165874354-165874376 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
965321796 3:167260958-167260980 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
965874292 3:173298915-173298937 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
966117608 3:176484647-176484669 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
966610356 3:181861960-181861982 TTTTGTTAGAGGGAACTGTATGG - Intergenic
966623829 3:181995175-181995197 CTCTGTCAGAGGGAAGATCTAGG - Intergenic
967275328 3:187768642-187768664 ATCAGGCAGAGGGAAGTGCAAGG + Intergenic
968125570 3:196157532-196157554 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
968720627 4:2200726-2200748 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
969117495 4:4880414-4880436 CTCTGTCAGAGGACGGTGGAGGG - Intergenic
970549223 4:17163052-17163074 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
970847407 4:20557111-20557133 CTCTGTCACATGAAAGTGCAAGG + Intronic
970996184 4:22269482-22269504 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
971183028 4:24348929-24348951 CTCTGTCAGAGGGAAGGCCTAGG + Intergenic
971246398 4:24932778-24932800 ATTAGTCAGAGGGAAGTGTCAGG + Intronic
973782493 4:54301294-54301316 CTCTGTCAGAGGGAAGGTATAGG - Intergenic
973831469 4:54764286-54764308 CTCTGTCAGAGGGAAGATCTTGG + Intergenic
974718423 4:65702490-65702512 CTGTGTCTGAGAGAAGTGCAGGG + Intergenic
974951055 4:68583113-68583135 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
975517341 4:75260850-75260872 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
975680295 4:76868888-76868910 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
976437090 4:85030427-85030449 CTGTGTCAGGGAGAAGTTTATGG - Intergenic
976856574 4:89610788-89610810 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
977019907 4:91746330-91746352 CTCTGTCAGAGGGAAGTTCTAGG + Intergenic
978858256 4:113418082-113418104 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
979561736 4:122108797-122108819 CTCTGTCAGAGGGAAGTCTAGGG - Intergenic
979638468 4:122983993-122984015 CTCTGTCAGAAGAAGGTCTAGGG - Intronic
979704924 4:123709737-123709759 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
980087120 4:128403233-128403255 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
980523727 4:133962143-133962165 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
980922711 4:139102920-139102942 CTCTGTCAGAATGCAGTGTCAGG + Intronic
981291348 4:143080046-143080068 CTGTGTTTGAAGGAAGTGTAGGG - Intergenic
981346731 4:143684517-143684539 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
981400887 4:144313032-144313054 CTCTGTCAGAGGGAAGGTCCAGG + Intergenic
981404849 4:144356062-144356084 CTCTCTCACAGGGCAGTGTGTGG + Intergenic
981461199 4:145014948-145014970 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
982075091 4:151730787-151730809 CTCTGTCAGAGGGAAGGTCCAGG - Intronic
982189848 4:152843046-152843068 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
982218678 4:153106483-153106505 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
982218687 4:153106540-153106562 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
982312063 4:153996805-153996827 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
982630649 4:157824963-157824985 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
982680055 4:158418527-158418549 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
982881629 4:160726170-160726192 CTCTGCCTGAGGGTAGTGTTTGG - Intergenic
983175609 4:164585134-164585156 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
983449879 4:167896018-167896040 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
983544840 4:168952545-168952567 CTCTGTCAGAGGGAAGGTTTAGG + Intronic
984266612 4:177504891-177504913 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
984527462 4:180874912-180874934 CTCTGTCAGAGGGAAGGTCTGGG + Intergenic
984721777 4:182978932-182978954 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
985008520 4:185559367-185559389 CTCTGTCACAGGAAGGTCTAGGG + Intergenic
987704296 5:21443785-21443807 CCCTGTCAGAGGGAAGGCCAAGG + Intergenic
988344698 5:30021634-30021656 TTCTGTCAGAGGGAAGGCTAGGG - Intergenic
988421109 5:31007507-31007529 CTATGTCAGAGGGAAGAGCTAGG + Intergenic
989027383 5:37083290-37083312 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
989431452 5:41360485-41360507 CTATGTCAGAGGGAAGACTTGGG + Intronic
990119272 5:52429431-52429453 CTCTGTCAGAGGGAAGATAATGG + Intergenic
990233419 5:53739851-53739873 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
990712747 5:58603934-58603956 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
991117471 5:62970571-62970593 CTCTGTCAGAGGGAAGGTCTGGG - Intergenic
991923964 5:71684937-71684959 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
992520243 5:77543166-77543188 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
992898739 5:81270976-81270998 CTATGTCAGAGGGAAGATTTGGG - Intergenic
992971727 5:82067229-82067251 GTCTGTGAGAGGGGAGAGTATGG + Intronic
993128502 5:83865684-83865706 CTCAGTCAGAGTGAAAGGTAAGG + Intergenic
994466393 5:100138615-100138637 CTCTGTAAGAGGAAAGAATATGG + Intergenic
994568285 5:101482396-101482418 CTCTGTCAGAGGGAAGGCCTAGG + Intergenic
994875396 5:105414506-105414528 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
995271754 5:110227891-110227913 CTCTGTCTTGGGGAGGTGTAAGG - Intergenic
995722598 5:115151890-115151912 CTCTGTCAGAGGAAATGTTAGGG - Intronic
995817905 5:116192173-116192195 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
996124057 5:119705566-119705588 CTCTGTCAGAGGGAAGGTTTAGG + Intergenic
996260213 5:121457685-121457707 CACTGTCAGAGGAAATTTTACGG + Intergenic
996288859 5:121828486-121828508 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
996325498 5:122268030-122268052 CTCTGTCAGAGGGAAGGTTTAGG - Intergenic
997157170 5:131573281-131573303 CTCTGTAAGAGGAAATTGTTGGG - Intronic
998746172 5:145261704-145261726 CTATGTCAGAGGGAAGATCAGGG - Intergenic
999484723 5:151984457-151984479 CTTTGTCAGAGGGAAGGTTTAGG + Intergenic
999913321 5:156230309-156230331 CTCTGTCAGAGGAAAGGTTTAGG + Intronic
1000508162 5:162147683-162147705 CTCTGTCAAAAGGAAGTGCTAGG - Intronic
1000779744 5:165465543-165465565 CTCTGTCAGAGGGAAGGCCTAGG - Intergenic
1002374727 5:178780568-178780590 CTATGTGAGAGGGATGTGTCGGG + Intergenic
1002960548 6:1910723-1910745 CTCAGTCTGAGGAAAGTGTAGGG + Intronic
1003450979 6:6230951-6230973 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1003930389 6:10919203-10919225 CTCTGTCAGAGGGAAGGTCTGGG + Intronic
1004085076 6:12439444-12439466 CTCTGACAGAGGGCAGGGTCTGG - Intergenic
1004681969 6:17904667-17904689 ATCTTTCAGAGTGAAGTGTGGGG - Intronic
1005072589 6:21875184-21875206 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1005161830 6:22872895-22872917 CACTGTCACAGGAAATTGTAAGG + Intergenic
1005305657 6:24511960-24511982 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1006256313 6:32835427-32835449 CTGTGTCAGAGGGAACGGTCAGG - Intronic
1006901983 6:37508563-37508585 CTGTGAGAGAGGCAAGTGTAAGG + Intergenic
1007892748 6:45310790-45310812 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1008115603 6:47545867-47545889 CTCTGTCAGAGGGAAGTGTAGGG - Intronic
1008256225 6:49303355-49303377 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1008305410 6:49892949-49892971 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1008992515 6:57619278-57619300 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1009181133 6:60518391-60518413 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1009384048 6:63068114-63068136 CTCTGTCACAGGGAAGGTTTGGG + Intergenic
1009413979 6:63395916-63395938 CTCTGTGAGAGGAGAGTGTTCGG + Intergenic
1009453265 6:63825755-63825777 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1009606044 6:65868266-65868288 CTTTGTTAGAGGTAAGTTTAGGG - Intergenic
1009608982 6:65912929-65912951 CTCTGTCATAAGTAAGTGTAAGG + Intergenic
1009798596 6:68503457-68503479 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1009800150 6:68527296-68527318 CTATGTCAGAGGGAAATCTGGGG + Intergenic
1009968926 6:70605508-70605530 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1010094903 6:72031255-72031277 TTCTGTCTGAGGGAAGTGTGGGG + Intronic
1010165013 6:72905505-72905527 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1010181800 6:73095551-73095573 CTCTGTCAGAGGGAAGATCTAGG + Intronic
1010679420 6:78781802-78781824 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1011168716 6:84479992-84480014 CTCTGTCAGAGGGGGTTCTAGGG - Intergenic
1011328984 6:86183319-86183341 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1011375428 6:86681595-86681617 CTATGTCAGAGGGAAGATTTGGG + Intergenic
1011760481 6:90559643-90559665 CTCTTTCAGAGGAAAGTAAAAGG - Intronic
1011789636 6:90884939-90884961 CTCTGTCAGAGGGAAGGTTGAGG + Intergenic
1012225167 6:96694928-96694950 CTCTGTCAGAGGGAAGGTCGAGG - Intergenic
1012922761 6:105235963-105235985 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1014304744 6:119726949-119726971 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1014398714 6:120960116-120960138 CTCTTTCAGAGGAAAGAGAATGG - Intergenic
1014738859 6:125124976-125124998 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1015663217 6:135599872-135599894 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1015877883 6:137842502-137842524 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1018252357 6:161883478-161883500 CTCTGACAAAGGGAAGGGAAGGG + Intronic
1019403096 7:867600-867622 CTCTCTCAGAAGGAAGTGCACGG + Intronic
1020358497 7:7303011-7303033 CTCTGTCAGAGGGAAGATCTGGG + Intergenic
1020373792 7:7462240-7462262 CCCTGTCAGAGGGAAGTTCCAGG - Intronic
1020634991 7:10685558-10685580 CTCTGTCAGAGGGAAGGTCTTGG - Intergenic
1020860878 7:13490102-13490124 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1023340880 7:39218318-39218340 CTCCATCTGAGGGAAGTGTGGGG + Intronic
1023701351 7:42894131-42894153 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1024917137 7:54514694-54514716 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1024944080 7:54791458-54791480 TTCTGTCAGAGGAAAGTACATGG + Intergenic
1026969878 7:74461294-74461316 CTCTGTCACAGGGAACAGGAGGG - Intronic
1027328943 7:77071122-77071144 CTCTGTCAGAGGGAAGGGCTAGG + Intergenic
1027855809 7:83509510-83509532 TTCTGTCATGGGGAAGGGTAAGG - Intronic
1028182862 7:87747102-87747124 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1029711883 7:102304245-102304267 CTGTGTGAGAGGGAAATCTAAGG - Intronic
1029786825 7:102800256-102800278 CTCTGTCAGAGGGAAGGGCTAGG - Intronic
1030390355 7:108920476-108920498 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1031261457 7:119525707-119525729 CTATGTCAGAGGGAAGATTTGGG - Intergenic
1031879314 7:127177860-127177882 CTCTGTCAGAGGGAAGATCTAGG - Intronic
1032289361 7:130574555-130574577 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1032638873 7:133742606-133742628 CTTTGTCAGAGAGAAATTTATGG - Intronic
1033018411 7:137696316-137696338 ATCTGTCTGAGGAAAGTGTGCGG - Intronic
1037388227 8:18365432-18365454 CTCTGTCCCAGGAAAGTGTAAGG - Intergenic
1039083199 8:33754800-33754822 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1039123677 8:34176196-34176218 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1039227798 8:35408083-35408105 CTCTGTCAGAGGAATGTTTGTGG + Intronic
1039571928 8:38593569-38593591 CTCTGTCAGAGGGAAGGTCCAGG - Intergenic
1039641560 8:39228191-39228213 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1039810411 8:41043432-41043454 GTCTGTCAGAGGGAAGGTTTAGG + Intergenic
1040800338 8:51332339-51332361 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1041637204 8:60157055-60157077 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1043040872 8:75260192-75260214 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1043205839 8:77438198-77438220 CTCTGTCAGAGGGAAGGTCAAGG + Intergenic
1043270794 8:78330277-78330299 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1045396726 8:101768244-101768266 CTCTGTCTGAGGGAAATTTCTGG - Intronic
1045685924 8:104712261-104712283 CTCTATCAGAGGAAAGGGTATGG + Intronic
1045757104 8:105556727-105556749 CTCTGTCAAAGGGGAGGGGAGGG - Intronic
1045779914 8:105850338-105850360 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1047834862 8:128678104-128678126 CTTAGTCAAAGCGAAGTGTAAGG - Intergenic
1048001896 8:130385608-130385630 CTCTCTCAGAGGGAAGTGATTGG + Intronic
1048257827 8:132918606-132918628 CTCTGCCAGAGGGAGGTGGCTGG + Intronic
1048497449 8:134946962-134946984 GTCTGTGGGAGGGAAGGGTAAGG + Intergenic
1049694228 8:143975805-143975827 CTCTGTCAAATGGAAGGGGAAGG + Intronic
1050502781 9:6315834-6315856 CTCTGTCAGAGGGAAGATCTAGG - Intergenic
1052246967 9:26347578-26347600 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1052731365 9:32290701-32290723 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1053600708 9:39606182-39606204 CTGTGAGAGAGGGGAGTGTAAGG + Intergenic
1054901141 9:70370743-70370765 CTTTGTCAGAGGGGAGGGGAGGG + Intergenic
1054957242 9:70926469-70926491 CTCTCTCAAAAGGAAGTGTTTGG + Intronic
1057949094 9:99355776-99355798 ATCTGTCAGACAGAAGTGGAAGG + Intergenic
1059609502 9:115877770-115877792 CTCTGTCAGAGGGAAGGTCTTGG + Intergenic
1059692990 9:116703759-116703781 CTCTGTAGGAGGGAAGTGGAAGG + Intronic
1059970118 9:119658618-119658640 CTTTTTCAAAGGGAGGTGTATGG + Intergenic
1062433096 9:136534818-136534840 CTCTGTGAGAGGGAACTGGGGGG - Intronic
1062576780 9:137212535-137212557 ATCTGACAGAGGGCAGTGGAGGG - Exonic
1062705160 9:137934840-137934862 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1185630873 X:1514908-1514930 CTCTGTCAAAGGGAAGGGAAGGG - Intronic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1187219113 X:17307256-17307278 CTCTGTCAGAGGGAAGATCTAGG + Intergenic
1187362853 X:18644338-18644360 CTCTGACAGAGGGCAGTGACAGG + Intronic
1187588950 X:20694078-20694100 CTATGTCAGAGGGAAGATTTGGG - Intergenic
1187630464 X:21164139-21164161 CTCTGTCTGAGGGCAGTAGATGG + Intergenic
1187748475 X:22434205-22434227 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1187773515 X:22729971-22729993 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1188045800 X:25425488-25425510 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1188400506 X:29738483-29738505 CTCTGTCAGGCTGGAGTGTATGG + Intronic
1188745097 X:33831479-33831501 CTCTGGCAGAGTGAAGGGAAAGG - Intergenic
1188890987 X:35610892-35610914 CTCTGTAAGAGGAAATTGTTGGG - Intergenic
1189413690 X:40795084-40795106 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1189879094 X:45470848-45470870 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1190339039 X:49281963-49281985 CTCTGCTAGAGGGAAGAGAAAGG - Exonic
1190449019 X:50558579-50558601 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1191151725 X:57227277-57227299 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1191779793 X:64853436-64853458 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1191806962 X:65146589-65146611 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1191965165 X:66750287-66750309 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1192014532 X:67315416-67315438 CTCTGTCAGAGGGAAGTTCTAGG + Intergenic
1192225272 X:69223085-69223107 CTCTGGCCGAAGCAAGTGTAGGG + Intergenic
1192731579 X:73806819-73806841 CTCTGTAAGAGGAAACTGTTGGG + Intergenic
1192820309 X:74637664-74637686 CTCTGTCAGAGGGAAGATCTGGG - Intergenic
1192881011 X:75284425-75284447 CTCTGTCAGAGGGAAGATCTAGG + Intronic
1192914197 X:75636192-75636214 CTCTGTAAGAGGAAATTGTTGGG + Intergenic
1192950963 X:76015348-76015370 CTATGTCAGAGGGAAGATTTGGG - Intergenic
1193062825 X:77224038-77224060 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1193077100 X:77365529-77365551 TTCTGTCAGAGGGAAGTTCTAGG - Intergenic
1193154680 X:78159420-78159442 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1193156952 X:78183863-78183885 CTCTGTCAGAGGGAAGTTCTAGG - Intergenic
1193253310 X:79318938-79318960 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1193425679 X:81338135-81338157 CTTTGTCCCAGGGAAGTGCACGG + Intergenic
1193583641 X:83294433-83294455 CTCTATCCCAGGGAAGTGCAGGG - Intergenic
1193680889 X:84518100-84518122 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1193779565 X:85685708-85685730 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1193937716 X:87642404-87642426 CTCTGTCAGAGGGAAGGTCTGGG - Intronic
1194882484 X:99271479-99271501 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1194942391 X:100027007-100027029 CTCTGTCAAAAGGGAGTGGAAGG + Intergenic
1195075974 X:101327238-101327260 CTCTGTCAGAGGGAAGGTCCAGG - Intergenic
1195231883 X:102858878-102858900 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1195972724 X:110491391-110491413 CTATGTCAGAGGGAAGAGCTAGG + Intergenic
1196270180 X:113700406-113700428 CTCTGTCACAGTGAAGAGCAGGG - Intergenic
1196590405 X:117480972-117480994 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1196696143 X:118614281-118614303 CACTTCCAAAGGGAAGTGTAAGG - Intronic
1196737587 X:118993031-118993053 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1196948185 X:120849718-120849740 CTCTGTCAGAGGGAAGGTTTAGG + Intergenic
1197364393 X:125545552-125545574 CTGTGTCAGAGGGAAGTTCTGGG - Intergenic
1197589001 X:128384765-128384787 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1197668989 X:129255356-129255378 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1198582980 X:138087252-138087274 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1198616536 X:138463855-138463877 CTCTGTCAGAGGGAAGGTCCAGG - Intergenic
1199201992 X:145102252-145102274 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1201394722 Y:13536454-13536476 CTCTGTCCCAGGGAAGAGAAGGG + Intergenic
1202036322 Y:20640694-20640716 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic