ID: 1008119959

View in Genome Browser
Species Human (GRCh38)
Location 6:47602023-47602045
Sequence GGGTTTAAAACAATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008119959_1008119967 10 Left 1008119959 6:47602023-47602045 CCCTCCTCCATTGTTTTAAACCC 0: 1
1: 0
2: 4
3: 19
4: 236
Right 1008119967 6:47602056-47602078 GTTTTTGTTCTAATCTATAAAGG 0: 1
1: 1
2: 2
3: 21
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008119959 Original CRISPR GGGTTTAAAACAATGGAGGA GGG (reversed) Intronic
902884523 1:19395224-19395246 GGGTTTAATACAACTGAGGCTGG + Intronic
904789049 1:33004569-33004591 GGTTTTAAAACAATACAGAATGG - Intergenic
905771195 1:40639054-40639076 GGCTTTGAAACAAAGAAGGATGG + Intronic
908082582 1:60597211-60597233 TGGTATAAAACAATGAAGAACGG - Intergenic
908292225 1:62679451-62679473 AGGGAAAAAACAATGGAGGAGGG + Intronic
908483522 1:64567885-64567907 AGGGGTAAAACAATGGTGGAGGG + Intronic
908889643 1:68830091-68830113 GGGCATGCAACAATGGAGGAAGG - Intergenic
909060620 1:70875063-70875085 AGGTTTAAAACACTAGGGGAAGG - Intronic
909323614 1:74321379-74321401 TGGTTTAAAACTGGGGAGGAAGG - Intronic
910241182 1:85087681-85087703 GGGGAAAAAAGAATGGAGGAGGG + Intronic
910439975 1:87241994-87242016 GGGTTTACAACCATGGAGTAGGG + Intergenic
911287742 1:96017947-96017969 GTGTTTACAACACTGTAGGAAGG + Intergenic
911407361 1:97459390-97459412 GGGTTTAATAGAATTGATGAAGG + Intronic
915829048 1:159108215-159108237 GGGTTTCATACAAGGGATGAAGG + Intronic
917209587 1:172617841-172617863 GGGTTCAAAAAAGTGGTGGAAGG + Intergenic
918244973 1:182651072-182651094 GGATTCAAAACTCTGGAGGAAGG + Intronic
919655463 1:200193114-200193136 GGCTTTATAAACATGGAGGAGGG + Intergenic
919695824 1:200574228-200574250 GGGTTTAGAACTTTGGTGGATGG - Intronic
920492091 1:206424301-206424323 GGATTTCTAACATTGGAGGAGGG + Intronic
920794473 1:209125323-209125345 GGATTCCAAGCAATGGAGGAGGG - Intergenic
923118122 1:230963336-230963358 GGGTTTAAAAGAATGGATGGAGG + Intronic
923288264 1:232518504-232518526 GCGTAGAAAACAAGGGAGGAGGG - Intronic
923300786 1:232638761-232638783 GGTTTTAAAGCAAGGGAGGAAGG - Intergenic
923805085 1:237248606-237248628 GCATGTAAAACAATGAAGGAAGG + Intronic
923985499 1:239377373-239377395 TGGTTTAAAACATTGTAGTAGGG + Intergenic
924416247 1:243859692-243859714 GGGCTTAAAACAGTAGATGAGGG + Intergenic
1065767839 10:29048167-29048189 TGGTTAAAAACAAAGGAGGGGGG - Intergenic
1068804477 10:61179565-61179587 GGATCTCAAACAATGTAGGAAGG + Intergenic
1072062705 10:91831399-91831421 TGGTTAAAAGGAATGGAGGAGGG - Intronic
1072351025 10:94557294-94557316 GGGTTTCAAACAAAGGAAAAAGG - Intronic
1075026021 10:118983690-118983712 GGGCTTACAACAATGGGGGGAGG - Intergenic
1075913061 10:126142524-126142546 GGGTTTACCAGAATGGAGCAAGG - Intronic
1076348007 10:129793877-129793899 GGGTAAAAAAGAAAGGAGGAGGG - Intergenic
1076934837 10:133560451-133560473 GGGTATAAAAAACTGGAGCAAGG + Intronic
1077905025 11:6525354-6525376 GGTTCTACAACAATAGAGGAAGG + Intronic
1078298847 11:10104362-10104384 CAGTTTGAAACAATGGTGGAAGG + Intronic
1078735220 11:14013462-14013484 GGGAATAAAAGAAAGGAGGAGGG + Intronic
1079481638 11:20886985-20887007 GGGTTTAATACAAAGGGGGATGG - Intronic
1080004162 11:27387597-27387619 GTGATTAAAACACAGGAGGAGGG + Intronic
1080673179 11:34400075-34400097 TGTTGTAAAACAATGGAGGAAGG - Intergenic
1082750703 11:57012458-57012480 AGGTTCAATTCAATGGAGGAAGG - Intergenic
1085103353 11:73820659-73820681 TGGATGAAAAAAATGGAGGATGG - Intronic
1086912087 11:92484574-92484596 AGCTTTAAAACATTGGATGATGG + Intronic
1087452340 11:98341051-98341073 GTGTTTGCTACAATGGAGGAAGG + Intergenic
1087767949 11:102176792-102176814 GGGTTGAAAACAATGGAGGCTGG + Intronic
1088402228 11:109433943-109433965 GGGTTTGAACCAATGGAGATAGG + Intergenic
1089909798 11:122085974-122085996 GAGTTTAAAAGAATGGAGGCCGG + Intergenic
1091436300 12:475661-475683 GGTTCTAAAATAATTGAGGAAGG - Intronic
1091488145 12:909246-909268 GGGGTAAAAAAAAGGGAGGAGGG - Exonic
1094799029 12:34008713-34008735 GGGTCTTAGAAAATGGAGGAAGG - Intergenic
1095551839 12:43451383-43451405 GGGTTTAGAAGATTGGAGGCAGG - Intronic
1095603790 12:44043840-44043862 GGGTTTGGAATAATGGTGGAAGG + Intronic
1095819995 12:46467555-46467577 TGGTTTACAACTATGAAGGAAGG + Intergenic
1099389166 12:82057714-82057736 GAGTTAAAAATGATGGAGGAGGG + Intergenic
1099577799 12:84403184-84403206 GGGTGTAATATAATGGTGGAAGG + Intergenic
1103458848 12:121088090-121088112 AGGTTTAAAACAACCCAGGAGGG - Intergenic
1104931416 12:132341293-132341315 GGGGGTAAAACATTGGGGGAGGG + Intergenic
1105247956 13:18669619-18669641 GGGACTAAAATAAGGGAGGAAGG - Intergenic
1105635027 13:22208402-22208424 GGGTTTGAAAGAATCCAGGAAGG + Intergenic
1106225828 13:27786314-27786336 GGGATTAAGCCAAAGGAGGAGGG - Intergenic
1106328879 13:28720267-28720289 GAGTTTCAAACAATGGAGCATGG + Intergenic
1108331375 13:49388195-49388217 GGTGTTACAACAATGGAGGGGGG + Intronic
1109332894 13:60952314-60952336 GCTTTTAAAAAAAAGGAGGAGGG - Intergenic
1110504668 13:76271798-76271820 GGATAGAAAAAAATGGAGGAAGG + Intergenic
1110897709 13:80776143-80776165 GTGTTTAAATGAATGGAGAATGG - Intergenic
1113556815 13:111242608-111242630 GGGTGAAAAAGAATGGAGGCAGG + Intronic
1113584303 13:111452943-111452965 AGGTTTAAAAGGATGGAGAATGG - Intergenic
1116199007 14:41767065-41767087 GGGTTTAAAACACTTAAGGGAGG + Intronic
1117021788 14:51578421-51578443 GGGTTTAAACCAAAAGAGGTCGG + Intronic
1117376289 14:55121080-55121102 GGGTTTGAAACCAGGCAGGAAGG - Intergenic
1117963297 14:61183170-61183192 GGCTTTGAAACCATGAAGGAAGG + Intergenic
1118477826 14:66134909-66134931 GGGCTTAAAAGACTGGAGGTGGG - Intergenic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1121412425 14:93757189-93757211 GGGTTTAAAAAAAGGAAGGAAGG + Intronic
1122187766 14:100014725-100014747 GGGTTGAAAACTGTGCAGGAAGG + Intronic
1124530481 15:30501110-30501132 GGGTATGAGACAATGGTGGAAGG + Intergenic
1124768178 15:32506578-32506600 GGGTATGAGACAATGGTGGAAGG - Intergenic
1124815935 15:32992148-32992170 TGCTATAAAACAATGGTGGATGG - Intronic
1125117825 15:36116272-36116294 CGGGTTAATACAATAGAGGAAGG - Intergenic
1126294248 15:47119478-47119500 GGGCTTACAACAAAGAAGGAAGG + Intergenic
1126294257 15:47119591-47119613 GGGCTTACAACAAAGAAGGAAGG - Intergenic
1126767011 15:52019483-52019505 GGGTCACACACAATGGAGGAGGG - Intronic
1129468574 15:75738024-75738046 GGGTTTGACGGAATGGAGGATGG + Intergenic
1131294771 15:91137302-91137324 ATTTTTAAAACAATGGAGGTGGG - Intronic
1131611712 15:93971249-93971271 GGGTTTGAAAAAAGGGAAGAAGG + Intergenic
1131720680 15:95165282-95165304 AGGTTTAAAACAATAAATGAAGG - Intergenic
1134852268 16:17489613-17489635 TGGATTAAACGAATGGAGGAAGG + Intergenic
1138518565 16:57555433-57555455 GGGTATATAATCATGGAGGAAGG - Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1141439320 16:84019368-84019390 GGGTTAAAAATATTGGAGGCTGG - Intronic
1142523062 17:518599-518621 GGGAGTAAAGAAATGGAGGAAGG + Exonic
1143942361 17:10555916-10555938 GCGTTAAAATCAATGGAGAATGG - Intergenic
1149018695 17:51938249-51938271 GGATTTAAAACATTGGAGAAGGG + Intronic
1150148613 17:62792105-62792127 GGGTCAACACCAATGGAGGAGGG - Intronic
1151139558 17:71978451-71978473 CTGTTAAAAACAATGGAGGCAGG - Intergenic
1152087261 17:78227855-78227877 GGGTTTAAAAGAAGAGAGGCAGG + Intergenic
1152434059 17:80264469-80264491 GTGTTTAAAACCCGGGAGGAGGG - Intronic
1153439592 18:5101775-5101797 GGATTTATAACAAAGGAGCAGGG + Intergenic
1153541428 18:6159987-6160009 GTGTTTAAAACAAGGGCTGAAGG + Intronic
1154304496 18:13220278-13220300 TCATTTAAAACAAGGGAGGAAGG - Intronic
1154440895 18:14389509-14389531 GGGACTAAAATAAGGGAGGAAGG + Intergenic
1155034825 18:22017309-22017331 TGATTCAAAACAAAGGAGGAAGG - Intergenic
1155550273 18:26957516-26957538 GGTTTTAAAACAAAGGATCAAGG - Intronic
1157738440 18:50071206-50071228 GGGTGAATAACAGTGGAGGAAGG - Intronic
1157763268 18:50280511-50280533 GTGGTTAAAACACTGAAGGAGGG - Intronic
1157824806 18:50803208-50803230 GGGTTTAAAAAAATGGTTGAAGG + Intronic
1158219346 18:55134307-55134329 GGTTTGAAAACAAGGAAGGAGGG + Intergenic
1161275866 19:3416817-3416839 GTTTTTAAAAAAATGTAGGATGG - Intronic
1163569782 19:18074310-18074332 GGGTTTCAAACCATGCAGAAAGG - Intronic
1163866596 19:19778190-19778212 GGGTTCACAATCATGGAGGAAGG - Intergenic
1163894936 19:20050619-20050641 CGGTTCAAAATCATGGAGGAAGG + Intergenic
1165420994 19:35721844-35721866 GGGTTGCAAAGAATGGAGGCTGG - Intronic
1168264969 19:55217798-55217820 GGGTTCCGAACAATGGGGGATGG - Intergenic
1168390598 19:56004269-56004291 GCCTGTAAAATAATGGAGGAGGG + Intronic
926255090 2:11186837-11186859 AGATCTCAAACAATGGAGGATGG - Intronic
926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG + Intronic
927985868 2:27409889-27409911 GGGATGAAAACACTGGAGGACGG - Intergenic
928467967 2:31540955-31540977 GGGTTTGCAACAATGGAATAAGG - Intronic
928734931 2:34277562-34277584 GAATTTAAAATAATGGAGGCCGG + Intergenic
928917793 2:36491696-36491718 TGGTTGAAAACCAGGGAGGAAGG - Intronic
934718984 2:96559802-96559824 TGGTTTAAAACAACAGAGGTAGG - Intergenic
935007421 2:99093064-99093086 GGGTTTCAAACCAGGGAGGCAGG + Intronic
935107605 2:100060097-100060119 GGGGTTGAACCAAAGGAGGATGG - Intronic
937881893 2:126874295-126874317 AGGCTTAAAACACTGTAGGAAGG + Intergenic
938227486 2:129628329-129628351 GGGTTTAGAACAATGGTGGAGGG - Intergenic
939906933 2:147928098-147928120 GGCTTTAAAACATGGGAAGAAGG - Exonic
940281289 2:151992291-151992313 GGGTATAAGACAATGCAGCATGG + Intronic
940337700 2:152546324-152546346 GGGTTTACAATCATGGCGGAAGG + Intronic
940797717 2:158098259-158098281 GGGGTGAAAATAAAGGAGGAGGG + Intronic
941095820 2:161238751-161238773 GGTGTTAAAACAATGGAGCCGGG + Intergenic
941387242 2:164868333-164868355 GGGTTAAAATCATGGGAGGATGG - Intergenic
941600518 2:167537605-167537627 GGCTTGAAAACAAGGAAGGAGGG - Intergenic
941680224 2:168390161-168390183 AGGGTTAAAAAAATGGAAGAGGG + Intergenic
942258232 2:174128919-174128941 AGGTTTAGAACAATGGAATATGG + Intronic
942497323 2:176553606-176553628 GAATTTTAAAAAATGGAGGAAGG - Intergenic
943063697 2:183064585-183064607 TGATTTAAAACGATGGGGGAAGG - Intergenic
943282869 2:185959978-185960000 GGGTTTTACACAAGGGAGGCAGG + Intergenic
944560465 2:200931447-200931469 TGCTTTAAAAAAAAGGAGGAGGG + Exonic
946250855 2:218411224-218411246 GGGAGTAAAACACTGGGGGAGGG + Intergenic
946550978 2:220801707-220801729 GGGTATAAAATAATGGCAGAAGG + Intergenic
947068588 2:226259606-226259628 AGAGTTAAAACAATGGAAGATGG - Intergenic
948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG + Intergenic
1169510271 20:6256309-6256331 GTGTTTAGGAAAATGGAGGAAGG + Intergenic
1170876513 20:20254650-20254672 GAGTTGAAGACAATGGGGGAAGG - Intronic
1173345129 20:42192311-42192333 GCTTTTAAAACAATAGAGGCTGG - Intronic
1173706361 20:45113297-45113319 GAATTTCAGACAATGGAGGAAGG - Intronic
1174301341 20:49584775-49584797 GGGGAGAAAGCAATGGAGGAGGG + Intergenic
1177045945 21:16170489-16170511 AGGTTTGAAAGAATGGATGATGG - Intergenic
1178763842 21:35430508-35430530 GGGTATAAAAGAAGGAAGGAAGG - Intronic
1179026961 21:37686886-37686908 GGGGTTGAAAAAATGGAGGGTGG + Intronic
1179063469 21:38002279-38002301 AAGTTCAAATCAATGGAGGAAGG - Intronic
1179240079 21:39582122-39582144 GGGTTTTTAAAAGTGGAGGAGGG + Intronic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1185267745 22:49913356-49913378 GGGTCTTCAACAAAGGAGGAGGG - Intronic
949286659 3:2414145-2414167 GGTTTTCTAACAATGTAGGATGG + Intronic
949967760 3:9373181-9373203 GGATTTAAACCAATGCAGCACGG - Intronic
950120407 3:10478693-10478715 GGGTTTCAAGAAATGTAGGAAGG - Intronic
953164758 3:40455013-40455035 GGCTTCAACACAATGAAGGAGGG + Intergenic
953519413 3:43627120-43627142 GGTTTGAAGACAATGGTGGATGG - Intronic
953628312 3:44589186-44589208 GGGTTAAAAAGAAAAGAGGAAGG - Intronic
954728832 3:52639864-52639886 TGGCTTAAAACAATGCAGGCTGG - Intronic
955796602 3:62643956-62643978 GGTTGTAAAAAAAGGGAGGAAGG + Intronic
956920846 3:73927545-73927567 GGGGTTAAAACACTGCATGAGGG - Intergenic
956936336 3:74106093-74106115 GGTTTTAAAACAACTGAGAATGG - Intergenic
957464680 3:80572216-80572238 AGGATTAAAGCAATGGTGGAAGG - Intergenic
960423539 3:117478266-117478288 AAATTTAAAACACTGGAGGATGG - Intergenic
963783092 3:149506956-149506978 GGGTTTAGAACAATTAATGAGGG + Intergenic
964198366 3:154089757-154089779 TGGTTTAAAAAAATGAAGCATGG + Intergenic
965375573 3:167919350-167919372 GGATCTGAAACAAAGGAGGAAGG - Intergenic
965750946 3:171974584-171974606 CGGGGTAACACAATGGAGGATGG + Intergenic
966388914 3:179430756-179430778 GAGTTTAAATCACTGGTGGAGGG - Intronic
968042296 3:195598880-195598902 TGGGTGAAAATAATGGAGGAGGG + Intergenic
968389350 4:176376-176398 GGGCTTAAAACAATGGGGTTGGG - Intergenic
968416015 4:434582-434604 GGGCTTGAAACAATGGGGGTGGG - Intronic
970061056 4:12034913-12034935 GGGTATTAAAAAATGTAGGAAGG - Intergenic
970580587 4:17470988-17471010 TGGGCTAAAGCAATGGAGGAAGG + Intronic
971714858 4:30162940-30162962 TGGTTTAAAAGAATAGAGAAGGG + Intergenic
975966821 4:79983873-79983895 GGAATTAAAAGAATGGAGGTTGG - Exonic
976319099 4:83691184-83691206 GGGATTAAAATAAGAGAGGAGGG + Intergenic
976508800 4:85883090-85883112 GGATTTAAAACAAGGCAGGGAGG + Intronic
977337650 4:95718658-95718680 GGGTATAAAACAATGGTGGAAGG - Intergenic
978959476 4:114658828-114658850 GGATGTCAAACAATGGAAGATGG - Intronic
981350848 4:143727964-143727986 GGGATGAAGACAAGGGAGGAGGG - Intergenic
982359685 4:154506065-154506087 GGTTTTAAAACAAGAGGGGAAGG - Intergenic
982799673 4:159688543-159688565 GGACTTGCAACAATGGAGGAAGG - Intergenic
983043732 4:162959906-162959928 AGGTTGAAAACAATGGTGGTGGG - Intergenic
983702100 4:170610136-170610158 GGGTTTCAAAGTTTGGAGGACGG + Intergenic
984205839 4:176786876-176786898 GGCAATAAAGCAATGGAGGAAGG + Intronic
984636913 4:182120820-182120842 GGTGTTATAAAAATGGAGGAAGG + Intergenic
985047028 4:185950973-185950995 GAGTTTAAAGCAAGGAAGGATGG + Intronic
988355461 5:30168191-30168213 GGGTTTAATACAAGGGATGCAGG + Intergenic
988983497 5:36595105-36595127 GAGTATAAAGCAGTGGAGGAAGG + Intergenic
989818371 5:45764441-45764463 GGCTTTATCACGATGGAGGATGG + Intergenic
992333351 5:75740432-75740454 GGGTGAAAAACAATGAAGCAGGG + Intergenic
992522653 5:77571608-77571630 GGCATTAAAACACTGAAGGAGGG - Intronic
993880961 5:93360314-93360336 GGGTTAAAAAAAATTGAGGAGGG + Intergenic
994279110 5:97878754-97878776 TGGTTTAAGAAAATGGAGCACGG + Intergenic
995416115 5:111915197-111915219 GGTTTTAAAACAATGATTGATGG + Intronic
995921297 5:117317169-117317191 GCATTTAAAAAAATGGAGAAAGG - Intergenic
996694193 5:126375879-126375901 GGGATTAACTCAATGGAGGCTGG - Intronic
996719855 5:126619225-126619247 GGGTTAAAAAGAATAAAGGAGGG - Intronic
998292686 5:140929795-140929817 GGGGTTAAAAGAAGGGAGAAAGG + Intronic
1000360341 5:160441280-160441302 GGGTTTAAAATATTGGGGGCAGG - Intergenic
1000569347 5:162893145-162893167 GGATTAAAAAGAATTGAGGAGGG - Intergenic
1000811109 5:165863185-165863207 GGATTAAAAAAAATGGAGGGAGG + Intergenic
1001681593 5:173561832-173561854 GAGTATAAAATAATGGAGGTTGG - Intergenic
1003187311 6:3843403-3843425 CGGTTTAAAAGAATGGAACATGG - Intergenic
1004615880 6:17288376-17288398 AGGTTTTAAAGAATGGTGGAGGG + Intronic
1006690361 6:35878671-35878693 GGGCTTAAAACAATGGAGGGGGG - Intronic
1007190156 6:40008464-40008486 GGGTTTAAAAAAATAGAATAAGG - Intergenic
1007866897 6:44981248-44981270 GGGTATAAATAAATGAAGGATGG + Intronic
1008119959 6:47602023-47602045 GGGTTTAAAACAATGGAGGAGGG - Intronic
1009925371 6:70114250-70114272 GGTTTTTAAACAATCGAGCAGGG - Intronic
1014165686 6:118221776-118221798 GGATTCAAAACAATACAGGAAGG - Intronic
1014586544 6:123204194-123204216 AGCTTTAAGACAATGAAGGAAGG + Intergenic
1015749038 6:136541583-136541605 GGGTATAAAACAATGCAGGGAGG - Intronic
1016554931 6:145325907-145325929 GGGTTTTAAACACTGGTGCATGG - Intergenic
1018571687 6:165217809-165217831 GGCCTCAAAACCATGGAGGAAGG + Intergenic
1019067937 6:169318191-169318213 GAGTTTATAAAAATGGGGGAAGG - Intergenic
1020147244 7:5654070-5654092 GGGTGGAAAACACTGGAGGGAGG + Intronic
1020916530 7:14200789-14200811 GTGTTTAACTCTATGGAGGATGG + Intronic
1024663173 7:51519403-51519425 GGATTTAAAACACTGGATGGAGG + Intergenic
1030028224 7:105345239-105345261 TGATTTAAAACACTGAAGGAAGG + Intronic
1030700249 7:112630281-112630303 AGGATAAAAAGAATGGAGGAGGG - Intergenic
1031019262 7:116609367-116609389 GGGTTTTTAACAGTGGGGGATGG + Intergenic
1032009253 7:128331707-128331729 GGGATTAAAAAAATGTTGGAAGG + Intronic
1034878633 7:154747025-154747047 GGAATAAAAACATTGGAGGAAGG + Intronic
1036412608 8:8516584-8516606 GGGATCAAAGCAATGGAGGAAGG - Intergenic
1036715983 8:11124631-11124653 GAGTTTAAAACACTGCAGGGGGG + Intronic
1037336074 8:17793361-17793383 GAGTATGAAACAATGGATGAGGG + Intronic
1038912575 8:31982936-31982958 GGTTTTAAAAGAATGGAGAAGGG + Intronic
1043849477 8:85199510-85199532 GGTGTTAAATGAATGGAGGAAGG + Intronic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1044455544 8:92388715-92388737 GAATTTAAAACTCTGGAGGAAGG + Intergenic
1044523231 8:93223722-93223744 GAGTTTTAAACAATGTAGGGTGG + Intergenic
1046182763 8:110673697-110673719 GGGTGGAAAACAATGGAGCAGGG - Intergenic
1046659071 8:116929077-116929099 GGGTTTAAGACAATTGAGGGAGG - Intergenic
1046934553 8:119873835-119873857 GGCCCTAAAACCATGGAGGAGGG + Exonic
1049652199 8:143775984-143776006 AGGTTGAAAAAAATTGAGGAGGG + Intergenic
1050600710 9:7247286-7247308 GTGCTTAGAACAATGCAGGAGGG + Intergenic
1055687498 9:78792719-78792741 TGGATGAAAACACTGGAGGAAGG + Intergenic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1060297072 9:122350112-122350134 GGGTTTGAATCAAGAGAGGAGGG + Intergenic
1062300164 9:135862036-135862058 TGATTTAAATCAATTGAGGAAGG + Intronic
1186678379 X:11845227-11845249 GGGTTTGAAAGAATGAAAGAGGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188344672 X:29049323-29049345 TGCTTTAAAACACTGGATGATGG - Intronic
1189792650 X:44618692-44618714 GGTGTTAAAACAGTGGAGGGGGG - Intergenic
1189853687 X:45201250-45201272 GGAATTAAAACAGTGGAGGGTGG - Intergenic
1190311409 X:49119549-49119571 GAGTTTAAAACAGTAGTGGAAGG + Intronic
1190650306 X:52562971-52562993 GGGTTCAGAACAAAGGAGAAAGG - Intergenic
1193162922 X:78248234-78248256 GGGTTTGAGGCAATGAAGGATGG - Intergenic
1193308111 X:79973221-79973243 GGCCTCAAAACAATGGTGGAAGG - Intergenic
1193512982 X:82429075-82429097 CTGTTTAAAACAACGGAGGCTGG + Intergenic
1193876999 X:86873030-86873052 GGGTTTAGGATAATGGTGGAAGG + Intergenic
1194106107 X:89768946-89768968 GTTTTTTAAACAATGGAGGCTGG - Intergenic
1197382359 X:125760626-125760648 GTATTTCAAACAATAGAGGAGGG - Intergenic
1197826336 X:130594383-130594405 GGTTTTAATAAAAAGGAGGAGGG - Intergenic
1200458063 Y:3416805-3416827 GTTTTTTAAACAATGGAGGCTGG - Intergenic
1201632610 Y:16085772-16085794 GGCTTTAAAATCATGGTGGAAGG + Intergenic