ID: 1008120097

View in Genome Browser
Species Human (GRCh38)
Location 6:47604362-47604384
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008120095_1008120097 12 Left 1008120095 6:47604327-47604349 CCTGAGAGAGTTTTAGAATAGTA 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1008120097 6:47604362-47604384 TTGGTGTCATAGTTCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr