ID: 1008123374

View in Genome Browser
Species Human (GRCh38)
Location 6:47642918-47642940
Sequence GTTTATGTGCAGGGTGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008123369_1008123374 7 Left 1008123369 6:47642888-47642910 CCTCCTGAATGTAAAACTATTGA 0: 61
1: 51
2: 26
3: 30
4: 173
Right 1008123374 6:47642918-47642940 GTTTATGTGCAGGGTGTATAAGG No data
1008123371_1008123374 4 Left 1008123371 6:47642891-47642913 CCTGAATGTAAAACTATTGAGGA No data
Right 1008123374 6:47642918-47642940 GTTTATGTGCAGGGTGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008123374 Original CRISPR GTTTATGTGCAGGGTGTATA AGG Intergenic
No off target data available for this crispr