ID: 1008123808

View in Genome Browser
Species Human (GRCh38)
Location 6:47646785-47646807
Sequence GTCCACATTGTTTGCAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008123808_1008123811 -3 Left 1008123808 6:47646785-47646807 CCAAAGTTGCAAACAATGTGGAC No data
Right 1008123811 6:47646805-47646827 GACCCACCTGGAGTCCCATCGGG No data
1008123808_1008123817 16 Left 1008123808 6:47646785-47646807 CCAAAGTTGCAAACAATGTGGAC No data
Right 1008123817 6:47646824-47646846 CGGGACTAGACAGCCTCCACTGG No data
1008123808_1008123810 -4 Left 1008123808 6:47646785-47646807 CCAAAGTTGCAAACAATGTGGAC No data
Right 1008123810 6:47646804-47646826 GGACCCACCTGGAGTCCCATCGG No data
1008123808_1008123818 26 Left 1008123808 6:47646785-47646807 CCAAAGTTGCAAACAATGTGGAC No data
Right 1008123818 6:47646834-47646856 CAGCCTCCACTGGATTATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008123808 Original CRISPR GTCCACATTGTTTGCAACTT TGG (reversed) Intergenic
No off target data available for this crispr