ID: 1008123813

View in Genome Browser
Species Human (GRCh38)
Location 6:47646808-47646830
Sequence AGTCCCGATGGGACTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008123813_1008123821 11 Left 1008123813 6:47646808-47646830 CCACCTGGAGTCCCATCGGGACT No data
Right 1008123821 6:47646842-47646864 ACTGGATTATACCGGATATGTGG No data
1008123813_1008123817 -7 Left 1008123813 6:47646808-47646830 CCACCTGGAGTCCCATCGGGACT No data
Right 1008123817 6:47646824-47646846 CGGGACTAGACAGCCTCCACTGG No data
1008123813_1008123818 3 Left 1008123813 6:47646808-47646830 CCACCTGGAGTCCCATCGGGACT No data
Right 1008123818 6:47646834-47646856 CAGCCTCCACTGGATTATACCGG No data
1008123813_1008123822 12 Left 1008123813 6:47646808-47646830 CCACCTGGAGTCCCATCGGGACT No data
Right 1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008123813 Original CRISPR AGTCCCGATGGGACTCCAGG TGG (reversed) Intergenic
No off target data available for this crispr