ID: 1008123817

View in Genome Browser
Species Human (GRCh38)
Location 6:47646824-47646846
Sequence CGGGACTAGACAGCCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008123814_1008123817 -10 Left 1008123814 6:47646811-47646833 CCTGGAGTCCCATCGGGACTAGA No data
Right 1008123817 6:47646824-47646846 CGGGACTAGACAGCCTCCACTGG No data
1008123806_1008123817 30 Left 1008123806 6:47646771-47646793 CCTTTAGTAAATTTCCAAAGTTG No data
Right 1008123817 6:47646824-47646846 CGGGACTAGACAGCCTCCACTGG No data
1008123808_1008123817 16 Left 1008123808 6:47646785-47646807 CCAAAGTTGCAAACAATGTGGAC No data
Right 1008123817 6:47646824-47646846 CGGGACTAGACAGCCTCCACTGG No data
1008123813_1008123817 -7 Left 1008123813 6:47646808-47646830 CCACCTGGAGTCCCATCGGGACT No data
Right 1008123817 6:47646824-47646846 CGGGACTAGACAGCCTCCACTGG No data
1008123812_1008123817 -6 Left 1008123812 6:47646807-47646829 CCCACCTGGAGTCCCATCGGGAC No data
Right 1008123817 6:47646824-47646846 CGGGACTAGACAGCCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008123817 Original CRISPR CGGGACTAGACAGCCTCCAC TGG Intergenic
No off target data available for this crispr