ID: 1008123818

View in Genome Browser
Species Human (GRCh38)
Location 6:47646834-47646856
Sequence CAGCCTCCACTGGATTATAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008123814_1008123818 0 Left 1008123814 6:47646811-47646833 CCTGGAGTCCCATCGGGACTAGA No data
Right 1008123818 6:47646834-47646856 CAGCCTCCACTGGATTATACCGG No data
1008123815_1008123818 -8 Left 1008123815 6:47646819-47646841 CCCATCGGGACTAGACAGCCTCC No data
Right 1008123818 6:47646834-47646856 CAGCCTCCACTGGATTATACCGG No data
1008123813_1008123818 3 Left 1008123813 6:47646808-47646830 CCACCTGGAGTCCCATCGGGACT No data
Right 1008123818 6:47646834-47646856 CAGCCTCCACTGGATTATACCGG No data
1008123812_1008123818 4 Left 1008123812 6:47646807-47646829 CCCACCTGGAGTCCCATCGGGAC No data
Right 1008123818 6:47646834-47646856 CAGCCTCCACTGGATTATACCGG No data
1008123816_1008123818 -9 Left 1008123816 6:47646820-47646842 CCATCGGGACTAGACAGCCTCCA No data
Right 1008123818 6:47646834-47646856 CAGCCTCCACTGGATTATACCGG No data
1008123808_1008123818 26 Left 1008123808 6:47646785-47646807 CCAAAGTTGCAAACAATGTGGAC No data
Right 1008123818 6:47646834-47646856 CAGCCTCCACTGGATTATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008123818 Original CRISPR CAGCCTCCACTGGATTATAC CGG Intergenic
No off target data available for this crispr