ID: 1008123822

View in Genome Browser
Species Human (GRCh38)
Location 6:47646843-47646865
Sequence CTGGATTATACCGGATATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008123816_1008123822 0 Left 1008123816 6:47646820-47646842 CCATCGGGACTAGACAGCCTCCA No data
Right 1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG No data
1008123814_1008123822 9 Left 1008123814 6:47646811-47646833 CCTGGAGTCCCATCGGGACTAGA No data
Right 1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG No data
1008123812_1008123822 13 Left 1008123812 6:47646807-47646829 CCCACCTGGAGTCCCATCGGGAC No data
Right 1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG No data
1008123813_1008123822 12 Left 1008123813 6:47646808-47646830 CCACCTGGAGTCCCATCGGGACT No data
Right 1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG No data
1008123815_1008123822 1 Left 1008123815 6:47646819-47646841 CCCATCGGGACTAGACAGCCTCC No data
Right 1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008123822 Original CRISPR CTGGATTATACCGGATATGT GGG Intergenic
No off target data available for this crispr