ID: 1008129953

View in Genome Browser
Species Human (GRCh38)
Location 6:47709925-47709947
Sequence CTGGCTTAGGAATGCTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008129953_1008129959 1 Left 1008129953 6:47709925-47709947 CCTGCCTAGCATTCCTAAGCCAG 0: 1
1: 0
2: 1
3: 12
4: 98
Right 1008129959 6:47709949-47709971 GAAGGCTGGAATGTGTCTTATGG 0: 1
1: 4
2: 10
3: 93
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008129953 Original CRISPR CTGGCTTAGGAATGCTAGGC AGG (reversed) Intronic
901673305 1:10868225-10868247 CTGGCTTATTAAGGCTGGGCAGG - Intergenic
901929612 1:12588697-12588719 CTGGGCTAGGAAGGCAAGGCTGG - Intronic
903450707 1:23452045-23452067 GAGGCTTAGGCAAGCTAGGCAGG - Intronic
905308381 1:37034056-37034078 CTGGTTTGGGAATACTGGGCCGG - Exonic
905901105 1:41582457-41582479 CTGGCTTGGGAGTCCTTGGCTGG + Exonic
906131957 1:43465512-43465534 ATGGCTTAGGTCTGCTAGGCAGG - Intergenic
906668976 1:47641201-47641223 CTGGCTTTGGACTGCTGGGGGGG + Intergenic
908409935 1:63853486-63853508 TTGGATTAGGAATGCTCAGCTGG + Intronic
912964776 1:114228026-114228048 CTTCCTTAGGAAGGCTGGGCTGG + Intergenic
916755761 1:167768836-167768858 CTGGTTCAGAAATGCAAGGCAGG + Intronic
918604862 1:186411189-186411211 TTGGGTTAGGAATGCTAAGCTGG + Intronic
1067559312 10:47293804-47293826 CTGGATTAGAAATGGTACGCAGG - Intergenic
1068778020 10:60888638-60888660 CGGCCTGAGGAATCCTAGGCGGG + Exonic
1072416745 10:95253251-95253273 CTGGATACAGAATGCTAGGCTGG - Intronic
1073534523 10:104263938-104263960 TTATCTTAGGAATGCTAGGATGG - Intronic
1074307701 10:112294126-112294148 CTGGCTTGGGAAAGCTTGGGAGG + Intronic
1075322004 10:121499007-121499029 CTGGGTTAAGAATGCTTGGTCGG - Intronic
1076307338 10:129474514-129474536 CTGGCTTTGGAAGGGTAGACAGG + Intronic
1076488943 10:130843420-130843442 CTAGCTCAGGAATCCCAGGCTGG + Intergenic
1079069947 11:17335794-17335816 CTTTCTTAGGAATAATAGGCTGG - Intronic
1080433549 11:32219651-32219673 TTGGCTCAGGAGTGCTAGGTTGG + Intergenic
1083368187 11:62155807-62155829 TTATCTTAGGAATGCAAGGCAGG + Intergenic
1085519697 11:77130759-77130781 CTGGGTTTGGAAGCCTAGGCAGG - Intronic
1086134814 11:83434980-83435002 ATGGCTTAGGAATCCCAGGCTGG + Intergenic
1089117462 11:116107622-116107644 CTATCTTATGACTGCTAGGCAGG + Intergenic
1090946396 11:131433151-131433173 CAGGTTTAAGAATGCTAGGCTGG - Intronic
1092873024 12:12823724-12823746 CTGGTTAAGGAATGCAAAGCTGG + Intronic
1092914785 12:13179909-13179931 CTGGCTTGGGAAGGCAAGGCTGG + Intergenic
1097353558 12:58576202-58576224 GTGGCTGAGTACTGCTAGGCTGG - Intronic
1100159314 12:91839638-91839660 CTAGCTTTGGAATGCTATGGAGG - Intergenic
1101079561 12:101169435-101169457 GTGGTTTAGGAGTGCTGGGCAGG + Intronic
1106557063 13:30818851-30818873 CTGGCTTAGGCATGCAAGGCTGG - Intergenic
1119735169 14:76976984-76977006 TTGGATTTGGAATGGTAGGCTGG - Intergenic
1128904792 15:71457266-71457288 CCAGCTTTGGAAGGCTAGGCTGG + Intronic
1139685059 16:68597010-68597032 CTTGCTTAGCAGTGCTAGGAAGG + Intergenic
1140804454 16:78520183-78520205 CAGGCATAGGATTGCCAGGCTGG + Intronic
1141242314 16:82275171-82275193 CTGGCTCAAGAAAGGTAGGCCGG + Intergenic
1141298355 16:82790935-82790957 CTGGCTTAGGAATTCTTAGTTGG - Intronic
1141994955 16:87630423-87630445 CTGGCTGGGGAATGCCAGGAAGG - Intronic
1147365192 17:39954462-39954484 CTGGCGTAGGGATGGTAGGTGGG - Intergenic
1151025063 17:70668790-70668812 CTGGCTTAGGCAGCCTAGACAGG + Intergenic
1160222529 18:76987909-76987931 CTTCCTTAGGAATTTTAGGCTGG - Intronic
1165143052 19:33713912-33713934 CTGGCTGAGGAGTGCAGGGCTGG + Intronic
1167073901 19:47237273-47237295 CGGGCTTAGGAAACCAAGGCAGG - Intergenic
927257072 2:21048918-21048940 CTGGCTCTGGAATGGTGGGCAGG + Intergenic
927908784 2:26881508-26881530 CAGGCTTAGGAATTCTGGACTGG + Intronic
931373267 2:61684157-61684179 TTGGCTTTAGAAAGCTAGGCTGG + Intergenic
937984148 2:127631049-127631071 CTGGCCTGGGAAGGCCAGGCAGG - Intronic
938497960 2:131813077-131813099 CTGTCTTAGGACTGCACGGCAGG + Intergenic
940721137 2:157283472-157283494 CTGGCATAGGAATGCAATCCAGG - Intronic
943332427 2:186575513-186575535 CTGACTTAGGGAAGCCAGGCTGG + Intergenic
945129723 2:206557616-206557638 CTGGCTAAGGAATTATAGGATGG + Intronic
1169217145 20:3800522-3800544 GAGGCTTAGGCATGCTAGCCAGG + Intronic
1169673442 20:8130005-8130027 GTGGCTTAGGAAGGCAAGACAGG - Intergenic
1170925905 20:20723568-20723590 CTTTCTTAGGAATTTTAGGCAGG - Intergenic
1172129265 20:32645034-32645056 CTGGCTTAGGAATGGGAAGGGGG - Intergenic
1173249402 20:41356734-41356756 CTGGCCTGGGAATCCTGGGCAGG + Intronic
1174401229 20:50277020-50277042 CTGGCTTAGGAAGGCGAGAGAGG - Intergenic
1175493175 20:59393009-59393031 CTGACTTAGTAATGCCAGGGAGG + Intergenic
1175930028 20:62489535-62489557 CTGTCTCAGAAGTGCTAGGCTGG - Intergenic
950532272 3:13559027-13559049 ATGGGTTAGGAAAGCTAGGTGGG + Intronic
950906487 3:16543749-16543771 CTGGCTGAGGAACGATAGCCGGG - Intergenic
953116063 3:39993569-39993591 ATGGTTTAGGATTGCCAGGCAGG - Intronic
954625777 3:52021213-52021235 CTAGCTTAGGAATGTAAGGAGGG + Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
955411427 3:58657966-58657988 CGGACTTAGCCATGCTAGGCTGG - Intronic
963582809 3:147147695-147147717 ATGGCTCAGGAGTGCTAAGCAGG + Intergenic
965725561 3:171711616-171711638 CTTGCTCAGGAATGCCAGGAAGG + Intronic
967512759 3:190331398-190331420 TTGTCTTTGGAATCCTAGGCAGG + Intronic
970017637 4:11530677-11530699 CTAGCCAAGGAATGCTGGGCTGG - Intergenic
971212427 4:24631903-24631925 GTGGCTTAGAAATGCTATGCTGG - Intergenic
973720072 4:53714494-53714516 CTGATTTAGGCATGGTAGGCTGG - Intronic
974792387 4:66709332-66709354 CTGGAATAGGAATGCTAAGGTGG + Intergenic
976095079 4:81500044-81500066 CTGGAATAGTAATGCTTGGCAGG + Intronic
976409967 4:84702312-84702334 CTGTCTTAGGAATGTTAGCCAGG - Intronic
977989566 4:103424551-103424573 CTGTCTGAGGAATGGTAGGAAGG + Intergenic
982199227 4:152943675-152943697 CTGCCTTGGAAATGCTAGGCAGG + Intronic
985252700 4:188040099-188040121 CTGGCTGAGGACTGCTTGTCAGG + Intergenic
986610322 5:9560818-9560840 CTGGCTTTGCAAAGCTGGGCAGG - Intergenic
992308703 5:75471458-75471480 CTGGCTTAGAAGTGGTATGCTGG + Intronic
996759240 5:126970529-126970551 ATGGGTTAGGAATGCTATTCAGG + Intronic
997019552 5:129982020-129982042 CTGTCTCAGGCATGCAAGGCTGG - Intronic
997449228 5:133968404-133968426 TGGGCTTAGGAAGGCTAGGAGGG - Intronic
998951021 5:147393270-147393292 CTGGGTTGGGAAGGCCAGGCAGG - Exonic
999243155 5:150138983-150139005 CTGGCTCTGGAAGGCTGGGCTGG + Intronic
1008129953 6:47709925-47709947 CTGGCTTAGGAATGCTAGGCAGG - Intronic
1009437004 6:63630477-63630499 CTAGCTCAGGAATGCTAGCATGG + Intergenic
1010079471 6:71842881-71842903 CTATCTTAGGTATGCAAGGCTGG - Intergenic
1010105982 6:72168589-72168611 TTGGTCTAGGAATGCTAGACTGG - Intronic
1021755919 7:23852095-23852117 TTGTCTCAGGAATGCAAGGCTGG + Intergenic
1022185004 7:27958780-27958802 CTGACTTGGGGATGCTAGGGTGG - Intronic
1036179333 8:6569452-6569474 CTGACTTTGGAATGCGAGGAAGG + Intronic
1037521149 8:19681739-19681761 CTGCCCTGGGAATGCCAGGCTGG + Intronic
1041780002 8:61567856-61567878 CAGGCTTAGGAGTGCTGGGTAGG + Intronic
1043879960 8:85531147-85531169 CTGGCTTAGTAAGTCTAGGGTGG - Intergenic
1045022937 8:98060221-98060243 CTGGCAGAGGCATGATAGGCAGG + Intergenic
1045120763 8:99031739-99031761 TGGGGTGAGGAATGCTAGGCAGG + Intronic
1045488935 8:102655114-102655136 CTGGCTCAGGAACGCGAGCCAGG - Intronic
1045571717 8:103374565-103374587 ATGGCTTATGTGTGCTAGGCTGG + Intronic
1046279979 8:112015343-112015365 ATAGTTTAGGAATGCAAGGCTGG + Intergenic
1049280037 8:141739669-141739691 CTGGCTTTGGAGTCCCAGGCTGG + Intergenic
1050612786 9:7370636-7370658 CTAGCTCAGGGCTGCTAGGCTGG - Intergenic
1051684862 9:19647536-19647558 CTGGCTTAGCAATGCCATGGAGG + Intronic
1060788111 9:126466316-126466338 CTGGCTTTGGAGTGCTGGGTCGG - Intronic
1061309914 9:129755419-129755441 CTGGCTTTGGGATTCGAGGCTGG - Intergenic
1062281436 9:135753708-135753730 CTAACTGAGGAATGCTGGGCTGG - Intronic
1192226725 X:69233682-69233704 CTGGCTTAGGTACTCTAGCCTGG - Intergenic
1196557790 X:117110637-117110659 TTGGCTTAGGCTTGCTAGCCTGG - Intergenic
1202272859 Y:23087321-23087343 CTGGCTGAGGAATGGTAGCCAGG - Intergenic
1202293167 Y:23333361-23333383 CTGGCTGAGGAATGGTAGCCAGG + Intergenic
1202425856 Y:24721065-24721087 CTGGCTGAGGAATGGTAGCCAGG - Intergenic
1202444933 Y:24949021-24949043 CTGGCTGAGGAATGGTAGCCAGG + Intergenic