ID: 1008129964

View in Genome Browser
Species Human (GRCh38)
Location 6:47710081-47710103
Sequence ATAGAAACACACATCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 2, 1: 14, 2: 118, 3: 191, 4: 790}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008129964 Original CRISPR ATAGAAACACACATCAAACA AGG Intronic
902034222 1:13445000-13445022 ACAGTAACATACATAAAACAAGG - Intergenic
902123520 1:14188505-14188527 ATAGAGACACACACAAAAGAAGG + Intergenic
903551139 1:24157966-24157988 CTAGAAACAGACCTCAGACAAGG + Intronic
903568759 1:24288486-24288508 ATAGAATCACACATAAAACAAGG - Intergenic
905098073 1:35492704-35492726 ATAAAAACTCACATCAAACTAGG + Intronic
905323697 1:37135136-37135158 AGAGAAACACACGGCACACAAGG - Intergenic
905696556 1:39978952-39978974 ATAGAAGCACATGTAAAACATGG + Intergenic
905917092 1:41692495-41692517 ACAGAAATACACATAACACAAGG + Intronic
906010407 1:42518960-42518982 ATAAAAACACTTAACAAACATGG - Intronic
907557239 1:55354884-55354906 ATAGCAAGACAAATCAGACATGG - Intergenic
907607335 1:55831141-55831163 ATAGAGGCAAACATCAGACAGGG - Intergenic
907924486 1:58943076-58943098 TTAAACACACACATCAGACAAGG + Intergenic
908701078 1:66901054-66901076 ATATAAACACGCAACAAACTAGG - Intronic
908799267 1:67862430-67862452 AGATAAACACACAACACACATGG + Intergenic
908903049 1:68978368-68978390 ATAAAAAGACAAATTAAACATGG - Intergenic
908968887 1:69800915-69800937 ATAGAAACCCTCAACAAACTAGG - Intronic
909002098 1:70230494-70230516 AAAGAAACAAACATTAACCAAGG - Intronic
909092208 1:71240216-71240238 ACACACACACACATAAAACAGGG + Intergenic
909257106 1:73438316-73438338 ATACAAACACATATCTGACAAGG - Intergenic
909383817 1:75034192-75034214 AAAGCAAGACACATCTAACATGG + Intergenic
909925289 1:81431178-81431200 ACACAAACACAAAGCAAACACGG - Intronic
910041244 1:82853932-82853954 ATAGAATCACACAGTTAACAAGG - Intergenic
910173750 1:84405883-84405905 ATACAAACATAGACCAAACATGG - Intronic
910239869 1:85074797-85074819 ACAGAAATACACATAAAACAAGG - Intronic
911035743 1:93545020-93545042 ACAGAAACACAAATAAAAAAAGG - Intronic
911818837 1:102389913-102389935 ATATAAACACTCAACAAACCGGG + Intergenic
911868055 1:103053136-103053158 ATAGAAATCCAAATTAAACAGGG + Intronic
911870549 1:103092463-103092485 ACACAAACACAGATCATACATGG + Intronic
911903739 1:103538538-103538560 ACATAAACACATATCAAACAAGG + Intronic
911929280 1:103881345-103881367 ATAAAAACAGTCAACAAACAAGG + Intergenic
912037725 1:105342569-105342591 ATATAAACACTCATAAAACAAGG - Intergenic
912268389 1:108183536-108183558 ACAGAAACAGACATAAGACATGG - Intronic
912343820 1:108945062-108945084 ACAGAAACACACATAAAACAAGG - Intronic
912989242 1:114467666-114467688 AAACAAACACAAGTCAAACAAGG + Intronic
913023811 1:114814467-114814489 ATAGAAATACACATCATATGTGG - Intergenic
913204326 1:116522493-116522515 ACAGAGACACACATAAAACAAGG + Intronic
913235520 1:116778029-116778051 ACAGAAACACACATAAAATTAGG + Intergenic
913376951 1:118163239-118163261 ATAGAAACACTTATAATACAAGG + Intronic
913572990 1:120140102-120140124 ATACAAACAGACAACAAACGTGG - Intergenic
914294250 1:146304907-146304929 ATACAAACAGACAACAAACGTGG - Intergenic
914555294 1:148755690-148755712 ATACAAACAGACAACAAACGTGG - Intergenic
914681430 1:149941158-149941180 ATAAAAACAAACATGATACAAGG + Exonic
914885462 1:151580975-151580997 ATAGAAAAACAAATCAGTCATGG + Exonic
914896022 1:151674454-151674476 AAATAAAAAAACATCAAACATGG - Intronic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
915847717 1:159285535-159285557 ATAAAAACACACATAAAATTTGG + Intergenic
916253356 1:162760884-162760906 ATAGATACACACACGAATCAGGG - Intronic
916900102 1:169213185-169213207 ACAGAAATACACACAAAACAAGG + Intronic
916950418 1:169774788-169774810 AAAGAAATAAACATCAAATAAGG + Intronic
916998705 1:170331059-170331081 ACAAAAACATACATAAAACAAGG - Intergenic
917127766 1:171705166-171705188 ACAGAAACACATATAAACCAAGG - Intronic
917386804 1:174485799-174485821 AGACAAAGACACATCAAAAAAGG - Intronic
917672718 1:177288303-177288325 ACAAAAACATACATCAGACAAGG + Intergenic
918023045 1:180713555-180713577 ATAAAAACTCTCAGCAAACAAGG - Intronic
918099670 1:181362750-181362772 TTAGAAACAAACATCAAGGAAGG + Intergenic
918259711 1:182784534-182784556 ATAGAAACAGAAATGAGACATGG - Intergenic
918377946 1:183928056-183928078 ACAGAAGCACAAATCGAACAGGG - Exonic
918571266 1:185996187-185996209 ACAGAAAGACAAATCAAACAAGG + Intronic
918885474 1:190187749-190187771 AAAGAAAAACACAAAAAACATGG - Intronic
919816895 1:201447040-201447062 ACAGAAACACATATAATACAAGG - Intergenic
920265458 1:204718429-204718451 ACAGAAACACACACAAAACAAGG + Intergenic
921049027 1:211497966-211497988 ATAGAAATGCACATAAAACAAGG + Intergenic
921080341 1:211733916-211733938 GCAGAAACACACATAAAACAAGG - Intergenic
921159241 1:212461480-212461502 ATAGAAATACACATAAAACAAGG - Intergenic
921269479 1:213454612-213454634 ATACACACACACACCAAAAAAGG - Intergenic
921346380 1:214189476-214189498 AAAGACACAAACATGAAACATGG - Intergenic
921636178 1:217496692-217496714 ACAGAATCACACACAAAACAAGG + Intronic
921668834 1:217904442-217904464 ACAGAAACACACATAAAACAAGG + Intergenic
922114339 1:222596289-222596311 ATGGAGACACTCATTAAACAGGG + Intergenic
922144537 1:222926576-222926598 AAAGAAACACACATAAAACAAGG - Intronic
923014305 1:230114066-230114088 AAGGAAACACACGTCAAAAACGG - Intronic
923128612 1:231055434-231055456 ACAGAAACACTCATGAAACAAGG + Intergenic
923199547 1:231698126-231698148 ACAGAAACACACATAGAACAAGG + Intronic
924201258 1:241661498-241661520 ATAGAAACATGCATACAACATGG - Intronic
924280844 1:242435616-242435638 ACAGAAACACACATAAAACAAGG + Intronic
924377516 1:243428707-243428729 ACACAAACACAGATCATACATGG + Intronic
924407241 1:243760933-243760955 ACAGAAACACACATAAAACCAGG + Intronic
1062766051 10:65968-65990 ATAAAAACACCCAACAAACCAGG + Intergenic
1062903312 10:1162087-1162109 ATAGAAACACACATTACAGAAGG + Intergenic
1062985082 10:1761146-1761168 ACAGAAGCACACACCCAACAAGG + Intergenic
1063086818 10:2827157-2827179 ACAGAAACACACTTAAAACGGGG - Intergenic
1063754666 10:8994163-8994185 ACAGAAACACACATAAAACAAGG + Intergenic
1063814144 10:9753599-9753621 ATAGATACTGTCATCAAACAAGG - Intergenic
1063979596 10:11443003-11443025 ATGGAAACACAGGTCAAATAAGG + Intergenic
1064389044 10:14925560-14925582 ACAGAAACACACATAAAACAAGG - Intronic
1064693971 10:17947494-17947516 AGACAAACACTCATCAAAAAGGG - Intergenic
1065227932 10:23565354-23565376 ATAGAAACATCTATGAAACAAGG - Intergenic
1065241135 10:23706453-23706475 ATAGAAACACTCAACAAAGTAGG - Intronic
1065327266 10:24560104-24560126 ATATAAACACCCAACAAATAAGG - Intergenic
1065623106 10:27603392-27603414 ACAGAAACCCACATGAAATAAGG - Intergenic
1065648507 10:27863080-27863102 ACAGAAATACACATAAAACAAGG - Intronic
1066255862 10:33678070-33678092 ATAGAAACACACACAAAACAAGG - Intergenic
1066459699 10:35602395-35602417 ACAGACACACACATAAAATAAGG + Intergenic
1066706104 10:38179679-38179701 ATAGAAACAAAGAGCAAACTGGG + Intergenic
1066981983 10:42424853-42424875 AGATAAACACACATCATCCAAGG + Intergenic
1067138857 10:43637876-43637898 AAACAAACATACATAAAACAAGG - Intergenic
1068612468 10:59075396-59075418 ATAGAAACATACATAAAACAAGG - Intergenic
1068632828 10:59315388-59315410 ATAAAGACTCACATAAAACATGG + Intronic
1069046039 10:63744453-63744475 ATAAAAACCCTCAACAAACAAGG + Intergenic
1069068234 10:63968234-63968256 ATAGAAACCCTCAGCAAACTAGG + Intergenic
1069210393 10:65751131-65751153 ATAGAAACACACATAAAATAAGG + Intergenic
1070109923 10:73475609-73475631 AATGAAACAAACATAAAACATGG - Intronic
1071582366 10:86784282-86784304 ATAAAAACACTCAACAAACTAGG - Intronic
1071811010 10:89180825-89180847 ACAGAAACACACATAAAACAAGG + Intergenic
1072099213 10:92213695-92213717 AATGAAACACAAAACAAACATGG + Intronic
1072123363 10:92423804-92423826 ATAAAAACTCACAGCAAACTAGG + Intergenic
1072136713 10:92554007-92554029 ACACAAAGACACATCAAAAAAGG + Intronic
1072187435 10:93053797-93053819 ATAGAAACAAACTTCAAAACTGG - Intronic
1072351261 10:94559797-94559819 ACAGAAACACAAATAAAACAGGG + Intronic
1072548961 10:96462636-96462658 ACAGAAACACACATAAAACAAGG - Intronic
1072954351 10:99875632-99875654 ATAGAAACACTCTTCACAAAAGG + Exonic
1073174752 10:101547964-101547986 ATAAAAACTCTCAGCAAACAAGG + Intronic
1073581574 10:104671657-104671679 ATAAAAACACTCAACAAACTAGG - Intronic
1073655802 10:105414755-105414777 ATAGAAACATGCAGCAAACTTGG + Intergenic
1073822808 10:107284304-107284326 AGAGAAAGACACATCAAGCAAGG - Intergenic
1073928187 10:108541996-108542018 ATGGAAACACATATTAAACCTGG + Intergenic
1075260624 10:120960696-120960718 ACAGAAACACACATAAAACACGG - Intergenic
1075382323 10:122029214-122029236 ATAAAAACCCACAGCAAACTAGG - Intronic
1075397200 10:122136072-122136094 ACAGAAGCACACATGGAACAAGG + Intronic
1075851809 10:125595118-125595140 ATAGAAATACACATTACAAATGG + Intronic
1076264225 10:129096976-129096998 ATTTAAACTCACAGCAAACAGGG - Intergenic
1076265352 10:129105288-129105310 AGAAAAACAAACATCAAACTTGG - Intergenic
1076644465 10:131943138-131943160 ATAGCATCACACATGAAAAAAGG - Intronic
1077526786 11:3071113-3071135 AGAGAAACACACATACAATAAGG - Intergenic
1077920004 11:6634532-6634554 ACAGAAACACACATCAAACAAGG - Intronic
1078494960 11:11808645-11808667 ATCAAAACAAAAATCAAACAAGG + Intergenic
1078504680 11:11925922-11925944 ATAAAAACACTCAACAAACTAGG - Intronic
1078651573 11:13199717-13199739 ATAAAAACACTCAACAAACTAGG + Intergenic
1078793392 11:14567994-14568016 ACAGAAACACACATAAAACTAGG + Intronic
1079299469 11:19264907-19264929 ACAGAAACACACATAAAACAAGG + Intergenic
1079514163 11:21247468-21247490 AAAAACACACACATCACACAGGG + Intronic
1079548496 11:21665060-21665082 ATAGAAAGAAACCTCAACCAAGG + Intergenic
1080351544 11:31390895-31390917 AGACAAAGACACATCAAAAAAGG + Intronic
1080351856 11:31393980-31394002 ACAAAAACAAACATAAAACAAGG - Intronic
1080856804 11:36118874-36118896 ATAGAAACAGAAATCAAACTGGG - Intronic
1080921133 11:36710428-36710450 AAAGAAACAGACATCATCCAGGG - Intergenic
1080943563 11:36946526-36946548 ATACAACTACACATCAAACAAGG + Intergenic
1081011223 11:37814390-37814412 ATAGAAACGCACATAAATCAAGG - Intergenic
1081044817 11:38260166-38260188 ATAAAAACTTTCATCAAACAAGG - Intergenic
1081208700 11:40305273-40305295 ATAAAAACAGACATCAGATAAGG - Intronic
1081748619 11:45490789-45490811 ACAGAAACACCCATAAAACAAGG + Intergenic
1082165915 11:48950431-48950453 ATAGAAACACAGATATAAAAGGG - Intergenic
1082610680 11:55293508-55293530 ATAGAAACACAGATATAAAAGGG + Intergenic
1082659262 11:55890168-55890190 ATAGAAACACAGATATAAAAGGG - Intronic
1082776769 11:57251315-57251337 ATAGCAACACAAAACAAACTAGG - Intergenic
1082949766 11:58800631-58800653 ATAAAAACACTCAACAAACTAGG + Intergenic
1084314281 11:68335379-68335401 TTAGAAACACACATAAGACAAGG - Intronic
1084920082 11:72462010-72462032 AGAAAGGCACACATCAAACATGG - Intergenic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085591883 11:77770646-77770668 ATAAAGAAACACACCAAACATGG + Intronic
1085654076 11:78296335-78296357 ACAGAAACACATATAAAACGAGG - Intronic
1085708894 11:78811641-78811663 ATAGAATCACACTTCAGAAATGG + Intronic
1085908767 11:80797027-80797049 ACAAAAACACACATAAGACAAGG + Intergenic
1086140659 11:83495216-83495238 ACAGACACACACATCTACCACGG - Intronic
1086602897 11:88657127-88657149 ACAAGAACACACATAAAACAAGG + Intronic
1086610220 11:88746747-88746769 ATATATTCACACATCAAAGATGG + Intronic
1086697054 11:89859706-89859728 ATAGAAACACAGATATAAAAGGG - Intergenic
1086709104 11:89984781-89984803 ATAGAAACACAGATATAAAAGGG + Intergenic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1087072258 11:94092778-94092800 AAAGAAACAGACATAAAACAAGG + Intronic
1087452050 11:98336747-98336769 ACAAAAACCCTCATCAAACAAGG - Intergenic
1087552509 11:99669598-99669620 CTAGAAAAATATATCAAACAGGG - Intronic
1087976487 11:104555257-104555279 ATAGAAACACACATGAAACAAGG + Intergenic
1088079929 11:105899746-105899768 ACACAAACACCCATAAAACAAGG - Intronic
1088390056 11:109304435-109304457 ACAGAAACACACATAAAACAAGG + Intergenic
1088464537 11:110120237-110120259 ACAGAAACACACATAAAACAAGG - Intronic
1088547948 11:110980623-110980645 ATAGAAAAACACATGAAGTAGGG + Intergenic
1088562559 11:111130602-111130624 ACAGAAACATATATAAAACAAGG - Intergenic
1088605209 11:111523408-111523430 ACAGAAACACACATAAAACAAGG + Intronic
1088713985 11:112532666-112532688 ACAGAAACACACACAAGACAAGG - Intergenic
1088966800 11:114731076-114731098 ATAAAAGCACTCATCAAACTAGG - Intergenic
1089033903 11:115364463-115364485 GTAGAAGCACACATCTATCATGG + Intronic
1089382214 11:118042959-118042981 ATAAAAACACTCAACAAACTAGG + Intergenic
1090179916 11:124687745-124687767 ATAAAAACACTCAACAAACTAGG + Intronic
1090592043 11:128282536-128282558 ATAGAAACATACATAAAGCAAGG + Intergenic
1090903275 11:131051290-131051312 ACAGAAACATACACAAAACAAGG + Intergenic
1091040337 11:132273082-132273104 AAAAAAACACACAACAAACTAGG - Intronic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1091267802 11:134284051-134284073 CTAGAAAGACTCATCACACAAGG + Intronic
1091357126 11:134945768-134945790 ATAGAATCACAATTCAAACCTGG + Intergenic
1091492642 12:946451-946473 ACAGAAGCACACATAAAACAAGG - Intronic
1091678532 12:2509488-2509510 ATAGAAACACACTTAAAACAAGG - Intronic
1091854402 12:3727734-3727756 TTAGAAACACTCGCCAAACAAGG + Intronic
1092438211 12:8470976-8470998 ATAAAAACACTCAGCAAACAAGG - Intronic
1092639550 12:10489279-10489301 ATAAAAACTCACAACAAACTAGG - Intergenic
1092911660 12:13150756-13150778 ATAAAAACACTCAACAAACTAGG + Intergenic
1093269718 12:17045049-17045071 ACAGAAATACACATGAAACAAGG + Intergenic
1093305816 12:17516333-17516355 ACAGAAACATGCATAAAACAAGG - Intergenic
1093504523 12:19849746-19849768 ACAGAAACACACATAAAACAAGG + Intergenic
1093602257 12:21042308-21042330 AGACAAACACACATCAAGAAAGG - Intronic
1093707802 12:22294673-22294695 AGAGAAACACAAATTACACATGG - Intronic
1093882408 12:24420048-24420070 AGAGAACCACACCTCAAGCATGG - Intergenic
1093912892 12:24767514-24767536 ACAGAAACATACATAAAACATGG + Intergenic
1094030197 12:26003135-26003157 ATAAAAACACTCAACAAACTAGG - Intronic
1094094028 12:26683590-26683612 ACAGAAGCACACATAGAACAAGG + Intronic
1094166799 12:27451461-27451483 ACAGAAACACATATAAAACGAGG - Intergenic
1094180164 12:27584098-27584120 ACAGAAACACACATAAAACAAGG - Intronic
1094248605 12:28332733-28332755 ACAGAAACACACATAAAACAAGG - Intronic
1094270994 12:28614316-28614338 ATAGATACACATTTAAAACATGG + Intergenic
1094781135 12:33793276-33793298 GTAAAAACACATAGCAAACATGG - Intergenic
1095685392 12:45027750-45027772 ATAGAACCAAACTTAAAACATGG - Intronic
1096040597 12:48512550-48512572 ACAGAAGCACACATAAAACAAGG + Intronic
1096399435 12:51293057-51293079 ACAGAAACTCACATAAAACAAGG + Intronic
1096549967 12:52365661-52365683 ATAGACACAGACATTAGACATGG - Intronic
1097448126 12:59700154-59700176 ACAGAAACACACATAAAACAAGG + Intronic
1097668588 12:62510595-62510617 ATAAAAACACTCAACAAACTAGG + Intronic
1098078694 12:66760364-66760386 ATAAAAACAAACCCCAAACAGGG + Intronic
1098124596 12:67277332-67277354 AAAGAAACACTCATAAAACGAGG - Intronic
1098221611 12:68275693-68275715 ACAGAAACACACATAAAACAAGG - Intronic
1098928097 12:76376015-76376037 ATAGAAGCATATATAAAACAAGG + Intronic
1099237425 12:80098198-80098220 ACAGAAATACACATAGAACAAGG - Intergenic
1099706330 12:86157701-86157723 AAAGAAAGACACATCTTACATGG + Intronic
1100512883 12:95294399-95294421 TTAGAAACAGAAATCCAACAAGG - Intronic
1100637734 12:96451261-96451283 ATAAAAACCCACAACAAACTAGG + Intergenic
1100662937 12:96719988-96720010 CCATAAACACACATTAAACAAGG + Intronic
1100873790 12:98941131-98941153 ACAGAAACACATATAAAACAAGG - Intronic
1101307847 12:103547552-103547574 ATAGAAAAACAAATTAGACATGG + Intergenic
1101584121 12:106069596-106069618 ACAGAGACACACATAAAACAAGG + Intronic
1101679029 12:106946956-106946978 AGAGAAACAGACATCTAAGAGGG - Intergenic
1101902492 12:108801013-108801035 AAGGAAACACACATTAACCAAGG + Intronic
1102063767 12:109955512-109955534 ACAGAAACACACGTAGAACAAGG - Intronic
1102422036 12:112811159-112811181 ACAGAAACACACATAAAACAAGG - Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1102976962 12:117213705-117213727 ATAGCAAGACACAACAAACAGGG + Exonic
1103050720 12:117777036-117777058 ACAGGAACACACCTAAAACAGGG - Intronic
1103158960 12:118711594-118711616 ATAGAAGCACTCACTAAACATGG + Intergenic
1105414654 13:20199423-20199445 ATCCAAACACCCATCAAAAAAGG - Intergenic
1105580441 13:21690999-21691021 ACAGAAACACACATAAAACAAGG + Intronic
1106073509 13:26436359-26436381 GCAGAAGAACACATCAAACATGG + Intergenic
1106586837 13:31064706-31064728 AGAGCAGCACACATCAAAAATGG + Intergenic
1106642871 13:31604176-31604198 GCAGAAACATACATAAAACAAGG - Intergenic
1106749525 13:32746441-32746463 ACAGAAACATACATAAAACAAGG - Intronic
1106772698 13:32977523-32977545 ACAGAAACACACACAACACACGG - Intergenic
1106877672 13:34091820-34091842 ATAGACACTCACATCTAATAAGG - Intergenic
1107036054 13:35903976-35903998 AGTGAAGCAAACATCAAACAGGG + Intronic
1107059431 13:36141262-36141284 ACAGAAACACATACAAAACAAGG + Intergenic
1107154125 13:37146456-37146478 ATACAACCACAAATCAGACATGG - Intergenic
1107282860 13:38756341-38756363 ATAGAAACACACATAAAACAAGG - Intronic
1107792849 13:44019489-44019511 ACAGAAACACATATAAAACAAGG + Intergenic
1108117329 13:47143712-47143734 ACAGAAACATATATAAAACAAGG - Intergenic
1108165696 13:47690700-47690722 ATTGACACACAAAACAAACAGGG - Intergenic
1108169518 13:47726897-47726919 ACAGACACACACATAAAATAAGG + Intergenic
1108214528 13:48171401-48171423 ATAAAAACTCTCATCAAACTAGG - Intergenic
1108456623 13:50621692-50621714 AAAGAAACTTACAACAAACACGG + Intronic
1108516194 13:51205145-51205167 AAAGAAACAAACAAGAAACAAGG + Intergenic
1108791719 13:53977113-53977135 ATAAAAACACTCAACAAACTAGG + Intergenic
1108805070 13:54144749-54144771 ATAGAACCACACATTTATCATGG + Intergenic
1108923454 13:55706565-55706587 ATTGAGACAAACAGCAAACAGGG + Intergenic
1109047425 13:57431101-57431123 ATAGAAACCCTCAACAAACCAGG + Intergenic
1109112432 13:58338637-58338659 AGACAAAGACACATCAAAAAAGG - Intergenic
1109380617 13:61554806-61554828 ATTGAAATACATTTCAAACATGG - Intergenic
1109604994 13:64681643-64681665 ATAAAAACACACAACAAACTAGG - Intergenic
1109727078 13:66355686-66355708 ACAGAAACACACATAAAACAAGG + Intronic
1109871081 13:68334734-68334756 ACAGAAACACACATAAAACAAGG - Intergenic
1110443063 13:75546968-75546990 ACAGAAATACACATAAAACAAGG - Intronic
1110516572 13:76419733-76419755 ACAGAAACACACACAAACCAGGG + Intergenic
1110565648 13:76955204-76955226 AAAGAATCTCACATAAAACAAGG + Intronic
1110776037 13:79409098-79409120 AAAGAAACACACATAAAACAAGG - Intergenic
1110796738 13:79646965-79646987 GAAGTAACACACATCACACATGG - Intergenic
1111009568 13:82293635-82293657 AAAGAAAGACACAACAAATAAGG + Intergenic
1111265788 13:85811351-85811373 AAAGAAACACACGTAAAACAAGG + Intergenic
1111355351 13:87093652-87093674 AAAGAAATGCACATTAAACAAGG - Intergenic
1111845641 13:93505376-93505398 ACAGTAACACACATAAAACAAGG - Intronic
1111910462 13:94305292-94305314 ACAGAAACACACATAACACAAGG - Intronic
1112057422 13:95703174-95703196 ACAGAAACACACAGAAAACAAGG - Intronic
1112121552 13:96417914-96417936 ACAGAAACACACATAAAACAAGG - Intronic
1112318130 13:98383011-98383033 ACAGAAACACACATAAGATACGG + Intronic
1112689224 13:101870992-101871014 ATACATACATACATAAAACAAGG + Intronic
1112714362 13:102166769-102166791 ATAGAAACACATATTAAACAAGG + Intronic
1112854862 13:103755945-103755967 ATATAAACACAAACCATACATGG + Intergenic
1112886112 13:104174028-104174050 ATAGAAAGTCACATCAACAATGG + Intergenic
1112959619 13:105107450-105107472 ATAGAAACTCTCAGCAAACTAGG + Intergenic
1113285301 13:108840071-108840093 GTAGAACCAGACATCAAACATGG + Intronic
1113345471 13:109473665-109473687 AGAGAAACACACTTCAGTCAAGG - Intergenic
1113545875 13:111149588-111149610 ACAAAAATACACATAAAACAAGG - Intronic
1113578149 13:111408952-111408974 ATAGAAACAAACATTAAACAAGG + Intergenic
1113979188 13:114258663-114258685 ATAGAAACACACATAAAACAAGG + Intronic
1114184828 14:20392818-20392840 AAAGAAACACACATGAAATAAGG + Intronic
1114381998 14:22216085-22216107 ATAGAAACCCTCAACAAACTAGG - Intergenic
1115013684 14:28583370-28583392 ATAAAAACACCCAACAAACTAGG - Intergenic
1115019829 14:28663180-28663202 ACAGAAACACACATCCAACAGGG - Intergenic
1115920722 14:38370268-38370290 ATCACAACACACATAAAACAAGG + Intergenic
1116032888 14:39593995-39594017 ATAAAAACACAAATAAAACAAGG - Intergenic
1116067752 14:40005817-40005839 ATAGAAAGTCACTTCAAACTTGG - Intergenic
1116248037 14:42443120-42443142 ATATAAACACGTATCAAAAAAGG + Intergenic
1116543176 14:46125939-46125961 TTTGAAACACTCATTAAACAAGG - Intergenic
1116574023 14:46550901-46550923 AAAGAAACACCCATAAAATAAGG + Intergenic
1116827990 14:49690544-49690566 ATAAAAACACACATAAAACAAGG - Intergenic
1116840111 14:49811625-49811647 ATAAAAACACTCAGCAAACTAGG - Intronic
1117055018 14:51903287-51903309 ACAGAAGCACACAGAAAACAAGG + Intronic
1118147205 14:63152004-63152026 ACAGAAGCCCACATAAAACAAGG - Intergenic
1118259446 14:64233702-64233724 AAAGAAACACACATAAAACAAGG - Intronic
1118424500 14:65644772-65644794 ATAGAAACACACATAAAACAAGG - Intronic
1118522943 14:66607153-66607175 ATAAAAACCCTCAACAAACAAGG - Intronic
1118668531 14:68097807-68097829 ATACAAACACACATCATTCCAGG + Intronic
1118920666 14:70146953-70146975 GCAGAAACACACATAAGACAAGG + Intronic
1119135818 14:72218575-72218597 ACAGAAACACATGTAAAACAAGG - Intronic
1119570965 14:75672048-75672070 ATAAAAACACACAACAAACTAGG - Intronic
1119572696 14:75689942-75689964 ATAGAATTACACATTAAAAAGGG + Intronic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1120428714 14:84386572-84386594 ATAAAAACACTCAACAAACTAGG + Intergenic
1120557048 14:85940341-85940363 ATGAAAACACACATCAAAGTAGG - Intergenic
1120763218 14:88304863-88304885 ACAGAAACACACATACAACAAGG + Intronic
1120957499 14:90095863-90095885 TCAGAAGCACAGATCAAACACGG - Intronic
1120958448 14:90103517-90103539 ATTCAAACACACATAAAACTAGG + Intronic
1121108935 14:91299146-91299168 ACAGAAACCCACATAAAACAAGG - Intronic
1121143867 14:91566520-91566542 ACAGAACCACACATAAGACAAGG - Intergenic
1121248199 14:92479387-92479409 ATGGAAACACTCAACAAACTAGG - Intronic
1121255876 14:92529932-92529954 ACAGAGACACACATAAAACAAGG + Intronic
1121366670 14:93318640-93318662 ATAAAAACACAAATCAGACTGGG + Intronic
1122170294 14:99867999-99868021 ATAAAAAAACACAACAAACTAGG - Intronic
1122456894 14:101860788-101860810 ATAAAAATACACAACACACAAGG - Intronic
1123980130 15:25594588-25594610 ACAGAAACACACATAAAACAAGG + Intergenic
1124006021 15:25796105-25796127 ATAGCAACACAAAACGAACAGGG + Intronic
1124364044 15:29059634-29059656 ACAGAAACACACATAAAACAAGG + Intronic
1124411217 15:29438861-29438883 ACAGAAACACACATGAAACAAGG + Intronic
1125016535 15:34942704-34942726 ATAGAAACACACATAAAATAAGG + Intronic
1125924443 15:43550786-43550808 ATAAAAACACTCAGCAAACTAGG - Intronic
1126342440 15:47656225-47656247 ATAGAAACACATATCAAACAAGG + Intronic
1127053555 15:55109685-55109707 ATGGAAACAAACAACAAACAAGG - Intergenic
1127345981 15:58098894-58098916 ATAAAAGCACTCAACAAACAAGG - Intronic
1127816106 15:62610376-62610398 ATAGAAACACACATAAAACAAGG - Intronic
1128106269 15:65047382-65047404 ATATATACACACATTAAAAATGG + Intronic
1128348808 15:66875363-66875385 ACAGAAACACACATGAAACAAGG - Intergenic
1128604280 15:69025159-69025181 ATAGAAACACACATAAAACAAGG - Intronic
1128781954 15:70364944-70364966 ATAGAAACTCTCAACAAACTAGG + Intergenic
1128859757 15:71057988-71058010 ACAGAAACACACATATAACAGGG + Intergenic
1128937212 15:71757090-71757112 ATAGAAACACATTTCTGACAGGG - Intronic
1129338654 15:74870423-74870445 AAAAAAACACACATAAAAAATGG + Intronic
1129633798 15:77292271-77292293 ACAGAAATACAGATAAAACAAGG - Intronic
1130451952 15:84064073-84064095 ATAGAAACTCTCAACAAACTAGG - Intergenic
1130969309 15:88719558-88719580 ACAGAAACATACATAATACAAGG - Intergenic
1131050571 15:89345004-89345026 ATGGAAACACACATAACACAAGG - Intergenic
1131381964 15:91971710-91971732 ACAGAAACACACTTAACACAAGG + Intronic
1132108289 15:99081965-99081987 ATAAAAACACTCAACAAACTAGG + Intergenic
1132333486 15:101028250-101028272 GCAGCAACACACATAAAACAAGG - Intronic
1132920137 16:2384796-2384818 ATAAAAACACTCAGCAAACTAGG - Intergenic
1133528126 16:6626437-6626459 ATAGATACACACACTCAACAGGG + Intronic
1133691048 16:8215719-8215741 AAATAAACAAACCTCAAACATGG + Intergenic
1134785148 16:16935453-16935475 ACAGAAACACACATAAAATGAGG - Intergenic
1134817391 16:17217058-17217080 ATAGAAACACACATGCAACAGGG + Intronic
1134818643 16:17227625-17227647 ATGAAAACCCTCATCAAACAAGG - Intronic
1134895542 16:17883244-17883266 ACAGAAACACACATAAAACAAGG + Intergenic
1135039108 16:19104267-19104289 ACACACACACACATGAAACAAGG - Intergenic
1135282290 16:21162971-21162993 ACAGAAATACACATAAAACGAGG - Intronic
1135459146 16:22626599-22626621 AGAAAAACCCACATCAAAAAAGG - Intergenic
1135634312 16:24060942-24060964 AAAGATACAAACATTAAACAAGG - Intronic
1136670997 16:31857450-31857472 ATAGAAACGCTCAACAAACTAGG + Intergenic
1137723842 16:50643737-50643759 ACAGAAGCACACATAAAACAAGG - Intergenic
1137969627 16:52971534-52971556 ATGGAAACACCCATGAAACAAGG - Intergenic
1137979600 16:53058435-53058457 ACAGAAACACACATAAACAAAGG + Intronic
1137994059 16:53189346-53189368 ATAAAAACACAAAACAAACTAGG - Intronic
1138228460 16:55320246-55320268 ATACACAGTCACATCAAACAGGG + Intergenic
1138300488 16:55923876-55923898 ATAAAAACCCTCATCAAACTGGG + Intronic
1138426294 16:56934617-56934639 AAAGCAACAAACAGCAAACAGGG - Intronic
1138470992 16:57236188-57236210 ACAGAAACAAAGATCAAAAAGGG - Intronic
1138906709 16:61344623-61344645 ATAGAAACACATATAAATCTAGG + Intergenic
1139023746 16:62786608-62786630 ATATAAACATACAACAAACTAGG - Intergenic
1139712502 16:68787111-68787133 ATATAAACACGCATCAATCTAGG - Intronic
1139784204 16:69378081-69378103 ATAAAAACACTCAGCAAACTAGG - Intronic
1140244985 16:73239977-73239999 ACAGGAACACACATAAAACGAGG - Intergenic
1140593892 16:76385726-76385748 ACAGAAACATACGTAAAACAAGG - Intronic
1140967649 16:79982874-79982896 ATAGATACACAAATAAAATATGG - Intergenic
1141775498 16:86120247-86120269 ACAGAAACACACATCATACAGGG - Intergenic
1142570248 17:868945-868967 AGAGAAAGACACAGAAAACACGG + Intronic
1142791891 17:2273201-2273223 ACAGAAACCCACATAAAACAAGG + Intronic
1143084881 17:4408223-4408245 TAAAAGACACACATCAAACAAGG + Intergenic
1143267104 17:5646759-5646781 ATATAGACAAACCTCAAACAAGG - Intergenic
1143605761 17:7984700-7984722 AAAAAAACACACCCCAAACAGGG - Intergenic
1144277920 17:13693316-13693338 ACAGAAACACACATAAAACAAGG + Intergenic
1146402225 17:32508859-32508881 TCAGAAGCACACAGCAAACAGGG - Intronic
1146403949 17:32521275-32521297 TTAGAAACACACCTAAAATAGGG + Intronic
1146637452 17:34517023-34517045 CTAAAACCACACAGCAAACAAGG - Intergenic
1149125585 17:53226972-53226994 ATCCAAACACACATAATACAGGG - Intergenic
1149624725 17:58072964-58072986 ATAAAAACACTCAACAAACTAGG + Intergenic
1149725546 17:58890158-58890180 GCAGAAACACATATAAAACAAGG - Intronic
1149885343 17:60334264-60334286 ATACAAACACAGATCGTACATGG - Intronic
1150177261 17:63071618-63071640 ATAGACAGAGACACCAAACATGG + Intronic
1150543520 17:66128883-66128905 ATAAAAACACACAGAAAAAAGGG + Intronic
1151409609 17:73913180-73913202 ATAGAAGCACACATCAATCTGGG + Intergenic
1152060824 17:78073737-78073759 ACAGAAAAACATATAAAACAAGG - Intronic
1152289880 17:79433889-79433911 ATAGAAACACCCTTAAAACAAGG - Intronic
1152958922 18:65535-65557 ATAAAAACACCCAACAAACCAGG + Intronic
1152974367 18:199770-199792 ACAGAAACACACATAAAACAAGG + Intronic
1153038400 18:786858-786880 ACAGAAACACACATATAACAAGG + Intronic
1153227335 18:2908808-2908830 ATAGAAACAGACATAGAACAAGG - Intronic
1153446908 18:5183808-5183830 ACAGAAACATATATTAAACAAGG - Intronic
1153531670 18:6053049-6053071 ATAGAAAGACACAATGAACAAGG - Intronic
1153821852 18:8838964-8838986 TGAGAAACACATAGCAAACAGGG + Intergenic
1154013853 18:10598732-10598754 ACAGAAACACAAATAAAACAAGG - Intergenic
1154124928 18:11683400-11683422 ATAGAAACCTACACCTAACAAGG - Intergenic
1154134735 18:11766367-11766389 ATACAAACACAAATTAAAAATGG - Intronic
1154153097 18:11922427-11922449 ACAGAAACACAAATAAAACAAGG - Intergenic
1154497553 18:14973533-14973555 ATAGAATCACAATTCAAACCTGG - Intergenic
1154995246 18:21634477-21634499 ACAGAAACACTCATAAAACAAGG - Intergenic
1155051712 18:22153881-22153903 ACAGAAACACACATAAAACAAGG + Intergenic
1155473839 18:26217939-26217961 ATAGAAACACACATGAAATAAGG - Intergenic
1155647595 18:28098460-28098482 ACAGAAATGCACATAAAACAAGG - Intronic
1155789539 18:29948238-29948260 ATACAAACACAAACCATACATGG - Intergenic
1156019589 18:32584615-32584637 ACAAAAACACACATGAAACAAGG - Intergenic
1156264351 18:35472788-35472810 GGAGAAAGACTCATCAAACAGGG - Intronic
1156576533 18:38323551-38323573 ATAAAAGCAAACATCAAAAAAGG + Intergenic
1156654516 18:39269294-39269316 ATAGAGCCATACATAAAACATGG + Intergenic
1156871087 18:41945809-41945831 ACAGAAACATACATGAAATAAGG - Intergenic
1156999356 18:43506063-43506085 ATAAAAACTCACAACAAACAAGG - Intergenic
1157137194 18:45067792-45067814 TTAGAAGCACATATCAACCAAGG + Exonic
1157303793 18:46501601-46501623 ACAGAAACACACATAAAACAAGG + Intronic
1157533992 18:48445045-48445067 ACAGAAGAAGACATCAAACAGGG - Intergenic
1158057599 18:53300585-53300607 ATAGAAACACACATAAAACAAGG + Intronic
1158118674 18:54025248-54025270 ACAGAAACTCACATTAAGCATGG - Intergenic
1158162532 18:54501782-54501804 ACAGAAACACACATAAAACAAGG + Intergenic
1158691108 18:59661633-59661655 ACAGAAATATACATAAAACAAGG - Intronic
1158817221 18:61116361-61116383 TTAGAAACACATAGAAAACAAGG + Intergenic
1159229424 18:65586952-65586974 AGAAAAATACACATCAAAAAAGG - Intergenic
1159367979 18:67494475-67494497 ACAGAAACACTCATGAACCAAGG + Intergenic
1159451686 18:68610882-68610904 ATACACACACACATAAAATAAGG + Intergenic
1160020664 18:75178237-75178259 GCAGAAACACATATAAAACAAGG + Intergenic
1160063481 18:75552696-75552718 ACAGAAGCACACTTAAAACAAGG + Intergenic
1160287158 18:77554373-77554395 ATAGGAACACTCATGAAGCATGG - Intergenic
1160367179 18:78336327-78336349 ACAGAAACACACATTATACAAGG + Intergenic
1161597384 19:5157538-5157560 TTAGACACACACAGCAGACATGG - Intergenic
1161923498 19:7283907-7283929 ACAGAAACACACATAAAACAAGG - Intronic
1161996295 19:7714048-7714070 ATACAAAGACACATCACACTGGG + Intergenic
1162922380 19:13911019-13911041 ACAGAAACACACATAGAGCAAGG + Intronic
1163217121 19:15888812-15888834 ATAGACACAGACAAAAAACATGG + Intronic
1164687189 19:30174629-30174651 AATGAAACACACATGAAACCAGG - Intergenic
1164910153 19:32004296-32004318 ATAGAAACATACAACAATAAGGG + Intergenic
1166016778 19:39986937-39986959 ATAAAAACTCTCATCAAACTAGG + Intronic
1166726559 19:45031935-45031957 ATATAAAAATACATAAAACAAGG + Intronic
1166883914 19:45947131-45947153 AGAGAAACACAAAATAAACAAGG - Intronic
1167141776 19:47656402-47656424 ACAGAAACACACATAAGCCAAGG + Intronic
1167188508 19:47965588-47965610 ACAGAAACACATATAAAAGAAGG + Intergenic
1167525559 19:49981572-49981594 ACAGAAACATACATAAAACAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167641294 19:50683393-50683415 ACAGAAACATGCATAAAACAAGG - Intronic
1167701835 19:51052992-51053014 AGAGAAACACACCTAAAACAAGG + Intergenic
1168382311 19:55934200-55934222 ACAGAGACACATATAAAACAAGG - Intergenic
1168427731 19:56252648-56252670 TAAGAAACAAACATCAAACATGG + Intronic
1168704483 19:58461664-58461686 ATAGAAACACTCATCACCAAGGG + Intergenic
924994581 2:346585-346607 ATAAAAACACTCAACAAACTAGG - Intergenic
925498885 2:4482701-4482723 ATACAAACAAACAACAAAAAAGG - Intergenic
926705149 2:15831908-15831930 ACAGAAACACACCTCAAACAAGG - Intergenic
926802380 2:16670160-16670182 ACAGAAACACACATAAAGCAAGG - Intergenic
926851976 2:17208702-17208724 ATAGAAATACTCAACAAACTGGG + Intergenic
927001587 2:18800632-18800654 ATATAAACAAACATGAAAGAAGG - Intergenic
927424407 2:22965435-22965457 ATAGAAATGCACTTCAAAAATGG - Intergenic
928160243 2:28916869-28916891 ATAGAAACAAACATAAAACAAGG - Intronic
928280964 2:29945964-29945986 ACAGAAACACACATAAAACAAGG + Intergenic
928494876 2:31821438-31821460 AGACAAAGACACATCAAAAAAGG - Intergenic
929043219 2:37766980-37767002 TAAAAAACACAAATCAAACAGGG + Intergenic
929064070 2:37955373-37955395 ATAAAAACACTCAACAAACTAGG - Intronic
929281327 2:40083191-40083213 AGACAAAGACACATCAAAAAGGG - Intergenic
930247213 2:48996456-48996478 ATAGAAACATATATAAAACATGG - Intronic
930523990 2:52503036-52503058 ATACTAACACACATCTAACCTGG - Intergenic
930760844 2:55034014-55034036 ATAGAAAAACACATAAAACAAGG + Intronic
930907279 2:56586854-56586876 ATAAAAACACTCAACAAACTAGG - Intergenic
931177442 2:59868213-59868235 ATAGAAACACACATACAACAAGG + Intergenic
931627063 2:64266094-64266116 ACAGAAACACACATAAAACAAGG - Intergenic
931799569 2:65745690-65745712 ACAGAAACACACATAAAGCAAGG - Intergenic
932079303 2:68697129-68697151 ATAGAAACATATATAAAACAAGG - Intronic
932408710 2:71531879-71531901 ACAGAAGCACACATAAACCAAGG + Intronic
933121674 2:78546066-78546088 AAAGAAACACTCAACAAACTAGG + Intergenic
933304137 2:80576649-80576671 ACACAAACTCACATAAAACAAGG - Intronic
933312712 2:80680457-80680479 ACAGAAACATCCATTAAACAGGG - Intergenic
933409046 2:81901887-81901909 AGAGAAAGACACATCAAATGAGG + Intergenic
933473187 2:82754238-82754260 AAAGCAGCACACAACAAACAAGG + Intergenic
933654023 2:84872794-84872816 GTAGAAGCACACATAAAACAAGG - Intronic
933671133 2:85008195-85008217 GCAGAAATACACATAAAACAAGG - Intronic
933850113 2:86359435-86359457 ATAGAAACACACATAAAGCAAGG + Intergenic
934528221 2:95066177-95066199 ACAGAAATTCACATAAAACAAGG - Intergenic
934593366 2:95579340-95579362 ATAGAAACACAGATATAAAAGGG - Intergenic
934693175 2:96377831-96377853 ATAGGAGCAGACATAAAACAAGG - Intergenic
934911708 2:98263423-98263445 ATAAAAACACTCAGCAAACTAGG - Intronic
935079578 2:99779209-99779231 ATAAAAACACCCAACAAACCAGG - Intronic
935080817 2:99792039-99792061 ACAGAAACACACATACAACAAGG + Intronic
935504883 2:103888359-103888381 GTAGAAACATACACCAAACCAGG + Intergenic
936167411 2:110134791-110134813 ATAAAAACACTCAACAAACTAGG + Intronic
936436560 2:112511948-112511970 ATGGAAACATACTCCAAACATGG - Intronic
936441904 2:112561623-112561645 ACAGAAACACACAAAAAACAAGG - Intronic
936598321 2:113870898-113870920 ACAGAAACACACATAAAACAAGG + Intergenic
936605658 2:113950134-113950156 AAAGAAACACACATGAAACAAGG - Intronic
936661724 2:114550375-114550397 ATAAAAATACACATCACCCAAGG - Intronic
937227855 2:120379867-120379889 ATATGAACACACATGCAACAGGG - Intergenic
937548456 2:123055282-123055304 ATAGAAACAAATATCAAAATAGG - Intergenic
937730906 2:125227744-125227766 ATAGAAACAAAAATGATACAGGG - Intergenic
938098766 2:128482608-128482630 ATAAAAACACTCAACAAACTAGG + Intergenic
938653212 2:133405206-133405228 ACAGAAACACACACAAAACAAGG - Intronic
938774581 2:134530257-134530279 TTAAACACACACATCAATCAAGG - Intronic
938788639 2:134656775-134656797 ATAAAAACCCTCAACAAACAAGG - Intronic
938803975 2:134788924-134788946 ACAGAAATACACACAAAACAAGG + Intergenic
938837013 2:135114627-135114649 ACAGAAACACACATAAAAGAAGG - Intronic
938918558 2:135969877-135969899 ACAGAAACACACACAAAAGAAGG - Intronic
938993346 2:136652322-136652344 ATTGAATCACACATCTGACAGGG + Intergenic
939354874 2:141088489-141088511 AGAGAAACACACCTGAAACGTGG + Intronic
939456453 2:142443374-142443396 ACAAAAACACATATAAAACAGGG + Intergenic
939875114 2:147568931-147568953 ATAGAAACTCACATACAAAAAGG + Intergenic
940069024 2:149664191-149664213 ACAGAAACACACATAAAACAAGG + Intergenic
940209454 2:151241597-151241619 ACAGAAACACACACCAAACAAGG - Intergenic
940319500 2:152361459-152361481 GTAGAAACAGACAATAAACAAGG - Intronic
940383163 2:153039535-153039557 ATAAAAACACTCACCAAACTAGG - Intergenic
940395868 2:153191254-153191276 ATAAATACACTCAACAAACAAGG - Intergenic
940549334 2:155132579-155132601 ATAAAAACACTCAACAAACTAGG + Intergenic
940558233 2:155259839-155259861 ATAAAAACACTCATCAAACTAGG - Intergenic
940952496 2:159692008-159692030 ATATAAACATAGATCATACATGG - Intergenic
941025920 2:160456053-160456075 AAAGAAATACAGATCAAACAGGG + Intronic
941038526 2:160594148-160594170 ATAAAAACACACAACAAACTAGG - Intergenic
941311644 2:163940084-163940106 AGAGAAACACACATGGAACAAGG + Intergenic
941567375 2:167126256-167126278 ATATAATCACACTTCTAACATGG + Intronic
942127012 2:172837120-172837142 ATACACACACACACCCAACATGG - Intronic
942715220 2:178883919-178883941 ATATGAAGACACATCACACAAGG + Intronic
942819482 2:180094941-180094963 AAATAAACAAACATCAAAGAAGG + Intergenic
943040925 2:182803997-182804019 ACAGAAACACACATAAAACAAGG - Intergenic
943167718 2:184351539-184351561 ATAGAAATACAAAAGAAACAAGG + Intergenic
943445586 2:187983090-187983112 ACAGAAACACATATAAAACAAGG + Intergenic
943613598 2:190065620-190065642 ACAAAAACATACATAAAACAAGG + Intronic
943770738 2:191713683-191713705 ATGGGAATACACACCAAACATGG - Intergenic
944210420 2:197201347-197201369 ATAAAAACACACAGCAAATTAGG - Intronic
944295564 2:198057976-198057998 ATAGAAATATCCATCAAAGAGGG + Intronic
944437860 2:199710407-199710429 ACAGAAACACACATATAACAAGG + Intergenic
944879424 2:203996468-203996490 ACAGAAACACACATTAGACTAGG + Intergenic
945141205 2:206688200-206688222 ATACAGAAACACATAAAACAAGG - Intronic
945371823 2:209028017-209028039 ACAGAAACACACATAAAACAAGG - Intergenic
945373765 2:209054463-209054485 ATAAAAACTCTCAACAAACAAGG + Intergenic
945680682 2:212910484-212910506 ATGGAAACACACATAAAAGAAGG + Intergenic
945711724 2:213305538-213305560 ATAGAAACCCTCAAAAAACATGG - Intronic
945741287 2:213665669-213665691 AAATAAACACACATAAAACAAGG - Intronic
945867012 2:215187639-215187661 GAAGAAACACACATAAAGCAAGG + Intergenic
945959546 2:216118143-216118165 ATACACACACACAACAAAAAAGG - Intronic
945970932 2:216231267-216231289 ATAAAAAAACACATAAGACATGG - Intergenic
946266968 2:218553262-218553284 ATAAAAACACTCAACAAACTAGG - Intronic
946665872 2:222049451-222049473 ACAGACACAAACATCAGACATGG + Intergenic
946672182 2:222116594-222116616 AAACAAACACACAAAAAACAAGG + Intergenic
947306644 2:228755523-228755545 ACAAAAACAAAAATCAAACATGG + Intergenic
947479362 2:230483906-230483928 ACAGAAACACATATAAAACAAGG - Intronic
947598273 2:231427840-231427862 ACAGAAACAAACATAAAAAAAGG - Intergenic
947788598 2:232848145-232848167 AAAGACACACACATAAAACAAGG - Intronic
947942944 2:234074767-234074789 ACAGAAACACACATAAAGCAAGG - Intronic
948014776 2:234679211-234679233 ATAGAAACACACATAAAACAAGG - Intergenic
948087274 2:235262026-235262048 ACGGAAACACACACAAAACAAGG - Intergenic
948289227 2:236812666-236812688 ACAGAAACACACATAAAACAGGG - Intergenic
1168749403 20:271478-271500 ACATACACACACATCAAAAATGG + Intronic
1169441971 20:5640226-5640248 AGAGAATCACACATCTCACATGG + Intergenic
1169516648 20:6323303-6323325 ACAGAAACACACATAAAACAAGG - Intergenic
1170171776 20:13421925-13421947 ACAGAAACACATATAAAATAAGG - Intronic
1170216315 20:13895559-13895581 AGAAAAACACTCAACAAACAAGG + Intronic
1170498485 20:16950278-16950300 GCAGAAACACAAATAAAACAAGG + Intergenic
1170682652 20:18540088-18540110 ATTGAAACACTCATCATTCATGG - Intronic
1170834711 20:19874280-19874302 CTAGAAACACACATAAAGCAAGG + Intergenic
1171219986 20:23387193-23387215 ATAAAAACACTCAACAAACTAGG + Intronic
1171224873 20:23434104-23434126 CTAGAGACACACATAAAATAAGG + Intergenic
1171228054 20:23457795-23457817 ATAAAATCACACTTCAAAAAGGG - Intergenic
1171775286 20:29361288-29361310 ACAAAAACACACAGCTAACATGG + Intergenic
1172012645 20:31854926-31854948 ACAGAAACACACAGAAAACAAGG - Intronic
1172524419 20:35589986-35590008 AAACAAACACACATAAAACAAGG + Intergenic
1172609750 20:36241215-36241237 ATAGAAATACACAGAAAAAAAGG - Intronic
1172648802 20:36488552-36488574 ACAGAGACACACATAAAACAAGG - Intronic
1173155916 20:40608671-40608693 ATAAAAACACTCAACAAACTAGG + Intergenic
1173190250 20:40870495-40870517 ATACACACACACACCACACATGG - Intergenic
1173494035 20:43506129-43506151 CTAGAAACAAACAACTAACATGG - Intergenic
1174135732 20:48377719-48377741 ACAGAAACACACATAAAACAAGG - Intergenic
1174227231 20:49011210-49011232 ACAGGAACACACATACAACAAGG + Intronic
1174587521 20:51620473-51620495 GTAGAAACGCACATAAAATAAGG - Intronic
1174605749 20:51760285-51760307 ACAGAAACACACCTAAAACGAGG + Intronic
1175432105 20:58912590-58912612 AAATAAACACACATAAAACCTGG + Intergenic
1175982645 20:62747201-62747223 ATAAAAACACTCAACAAACTGGG + Intronic
1176922719 21:14707754-14707776 AAAGCAAGACACATCATACATGG + Intergenic
1177040873 21:16108992-16109014 ACAGAAGCACACATAAAACAAGG + Intergenic
1177311238 21:19396210-19396232 ACTGAAACACACATGAAATAAGG - Intergenic
1177477363 21:21641477-21641499 ATATAAACACACATAACACAAGG + Intergenic
1177598921 21:23285659-23285681 AGAGAAAAACACATCTTACATGG + Intergenic
1177747621 21:25239136-25239158 ATAAAAACACTCAACAAACTAGG + Intergenic
1178072163 21:28980364-28980386 ACAGAAACACACATAAAACAAGG + Intronic
1178245736 21:30949705-30949727 ATAAAAACATTCAACAAACAAGG + Intergenic
1178613665 21:34110756-34110778 ACAGAAACACACATGAGGCAAGG - Intronic
1178635222 21:34296586-34296608 ATAGAAACACACATAGAAGGAGG - Intergenic
1178901101 21:36599399-36599421 ACAGAAGCACACATAAAGCAGGG - Intergenic
1178906365 21:36640322-36640344 AGTGAAACACAAATCAAAAAGGG + Intergenic
1181406741 22:22690326-22690348 ATGTAATCACACATCACACAGGG + Intergenic
1181974067 22:26715853-26715875 ACAGAAACACACATAAAACTTGG - Intergenic
1182302933 22:29348563-29348585 ACAGAAACACACATTTAAAAAGG + Intronic
1183230833 22:36580852-36580874 ATACACACACACAACACACAGGG + Intronic
1183844902 22:40534764-40534786 CTAGATAAACACACCAAACATGG - Intronic
1184181966 22:42835071-42835093 ATAGAAACACATGTTAAATAAGG + Intronic
1184197852 22:42943559-42943581 ACAGAAACACTCAGCAAACCAGG - Intronic
1184347016 22:43919873-43919895 CCAGGAACACACATAAAACAAGG - Intergenic
1184916615 22:47573754-47573776 ATGCACACACACATCATACAAGG - Intergenic
949159650 3:865180-865202 ATAAAAACACACCTGAAAAATGG - Intergenic
949264004 3:2135945-2135967 AGAAAAAAACAGATCAAACATGG - Intronic
949336177 3:2978148-2978170 ATAGCAACACACCACAAACTAGG - Intronic
950215946 3:11159392-11159414 AAAGAAACACTCAGCAAACTGGG - Intronic
950281965 3:11715780-11715802 ACAGAAACATACGTAAAACAAGG - Intronic
950769005 3:15295988-15296010 ACAGAAACACACATATAACAAGG + Intronic
951087909 3:18536543-18536565 ATAGAAACACACATAAAACAAGG + Intergenic
951142241 3:19176914-19176936 ATAGAAATACACATAAAACAAGG - Intronic
951178393 3:19629137-19629159 AAAGAAAAACAAATCAGACACGG + Intergenic
951642289 3:24849533-24849555 ACAGAAACACACATAAAACAAGG - Intergenic
952168219 3:30775322-30775344 AGAGAATCACAAATCAAATAAGG - Intronic
952493599 3:33896001-33896023 ATAGATAAACACATCACATATGG - Intergenic
952518935 3:34135276-34135298 ATAAAAACAACCATCAAACTAGG + Intergenic
952784670 3:37141483-37141505 ATACAAAAACCCATTAAACAAGG + Intronic
953180876 3:40594107-40594129 ACAAAAACACACATTAAACAAGG - Intergenic
953252547 3:41259957-41259979 ACAGACACACACTTCACACAGGG + Intronic
953751656 3:45613254-45613276 ATAGAAGCACACATAAAACAAGG + Intronic
953806287 3:46071769-46071791 ATAAAAACACTCAACAAACTAGG + Intergenic
953896234 3:46805113-46805135 AAAGGAACATACATAAAACAAGG - Intronic
954181413 3:48884050-48884072 AAAGAAGCACACGGCAAACATGG + Exonic
954874659 3:53793902-53793924 ACAGACACACACAGCAAACTTGG + Intronic
955206651 3:56901832-56901854 GCAGAAATACACATAAAACAAGG - Intronic
955944424 3:64178815-64178837 AAAGAAACACACATGAAACAAGG - Intronic
956186177 3:66564405-66564427 ACAAAAACATACATAAAACAAGG - Intergenic
956385755 3:68717279-68717301 ACAAAAACACACATAAAACAAGG + Intergenic
956456337 3:69424124-69424146 ACAGAAACACACTTAAAACAAGG + Intronic
956837462 3:73107118-73107140 AATGTAACACACATCTAACATGG + Intergenic
956967251 3:74476170-74476192 AGAGAAACACACACAAAACAAGG + Intronic
957381549 3:79436334-79436356 AAAAAAATACAAATCAAACATGG - Intronic
957421602 3:79978762-79978784 AGAGGAACACACATCACCCAAGG - Intergenic
957656724 3:83088225-83088247 ACAGAAACACATATAAAACAAGG - Intergenic
957695085 3:83625957-83625979 ATAGAAACAAACATTAGAAATGG - Intergenic
957795438 3:84999316-84999338 ATAGAAACACACATACAAAAAGG - Intronic
957965377 3:87315878-87315900 ATAGAAATACACATAAAACATGG + Intergenic
957968954 3:87358890-87358912 ACAGAAATACAAATAAAACAAGG - Intergenic
958062187 3:88497581-88497603 ACAGAAATGCACATTAAACAAGG - Intergenic
958409656 3:93801125-93801147 ATAAAAACACCCAACAAACTGGG + Intergenic
958850275 3:99316469-99316491 ACAGACACACACATTAAACAAGG + Intergenic
959017485 3:101152023-101152045 ATTAAAACATACATCAGACAAGG - Intergenic
959025329 3:101234241-101234263 ACAGAAACACACAGGAAACAAGG + Intronic
959195726 3:103179198-103179220 AGACAAAGACACATCAAAAAAGG + Intergenic
959371027 3:105526076-105526098 ATATAACCAGACATCAAAAATGG + Intronic
959455267 3:106552228-106552250 ATAGACACACACTTAATACATGG - Intergenic
959471155 3:106752013-106752035 ACAGAAAGACACATAAAATAAGG + Intergenic
959497378 3:107067283-107067305 TTAGTAACACAAATAAAACATGG - Intergenic
959832318 3:110879285-110879307 TTAGGAACACACATGAAAGAAGG - Intergenic
959886956 3:111514153-111514175 GTAGACACACACATAATACAGGG + Intronic
960294768 3:115929538-115929560 GTGAAAATACACATCAAACAGGG + Intronic
960366193 3:116775782-116775804 ACAGAAAAACACATGAAACACGG + Intronic
960570585 3:119181775-119181797 CTAGAAAGACAAATAAAACAGGG + Intronic
960650974 3:119949593-119949615 ATATAAACCTTCATCAAACATGG + Intronic
960798933 3:121518123-121518145 ACAGAAACATGCATAAAACAAGG - Intronic
961775818 3:129284433-129284455 ACAGAAACACACATAAAACAAGG + Intronic
962062926 3:131950183-131950205 AAAGAAGCACACATAAAACAAGG - Intronic
962595475 3:136938736-136938758 AGAGAAACACACATAAAACAGGG + Intronic
962651622 3:137499419-137499441 ATAAAAACCCACAACAAACTAGG - Intergenic
962761078 3:138515227-138515249 ATAGAAACATACAGACAACAAGG - Intronic
963407516 3:144885688-144885710 ACAGAAACACGCATTAGACAAGG - Intergenic
963577007 3:147073507-147073529 ATAAAAACCCTCAACAAACAAGG + Intergenic
963877830 3:150496591-150496613 ATGGCAACACACCTAAAACAAGG - Intergenic
964088184 3:152843632-152843654 TGAGGAACACACAACAAACAAGG - Intergenic
964284946 3:155108057-155108079 ACAGAAACACACATAAAACAAGG + Intronic
964911888 3:161792721-161792743 ATAGAAATAGATAACAAACATGG + Intergenic
965010050 3:163076077-163076099 ATAGAAACTTACAAAAAACAGGG + Intergenic
965351929 3:167623498-167623520 ATAAAAACACTCAACAAACCAGG + Intronic
965513706 3:169597883-169597905 AGAGAAATACACACTAAACATGG + Intronic
965793003 3:172410172-172410194 ATATACACACACACCAAACTAGG + Intergenic
965891922 3:173524745-173524767 ATAAAAACCCACAACAAACTAGG - Intronic
965979991 3:174677650-174677672 ACAGAAACACACATAAAACAAGG - Intronic
966394166 3:179484872-179484894 ACAGAAACACACATTAAACAAGG + Intergenic
966464848 3:180219001-180219023 ATAAAAACTCACATTAAACTGGG + Intergenic
967005869 3:185381806-185381828 ACAGAAGCACACATAAAACAAGG + Intronic
967621532 3:191640193-191640215 TTAGAAACAGACATAAAAAATGG + Intergenic
967656729 3:192059290-192059312 ACAGAAACAAATATAAAACAAGG - Intergenic
967769249 3:193315859-193315881 ACACACACACACATAAAACAGGG - Intronic
968884299 4:3319052-3319074 GTAGAAATATTCATCAAACACGG - Intronic
969122114 4:4918404-4918426 AGAAAAACAAACAACAAACATGG + Intergenic
969318904 4:6398925-6398947 ATTGACACACACAGCAACCAGGG + Intronic
970674816 4:18437183-18437205 ATATACACACACATAATACAAGG - Intergenic
970891631 4:21052094-21052116 ATAGGAACAGACAAAAAACAAGG - Intronic
971136157 4:23871046-23871068 ATTGAAAGACAAATTAAACAGGG + Intronic
971235766 4:24840844-24840866 ACAGAGACACACATAAAACAAGG + Intronic
971427184 4:26527823-26527845 ACACAAACACACATAAAACAAGG + Intergenic
971427264 4:26528850-26528872 ACACAAATACACATAAAACAAGG - Intergenic
971491898 4:27221575-27221597 ATAAAAACACTCAACAAACAAGG - Intergenic
971653513 4:29310594-29310616 AGAGATTCAAACATCAAACATGG + Intergenic
971956219 4:33422621-33422643 GGAGAAACAGACATTAAACAAGG + Intergenic
972064409 4:34922594-34922616 ACAGAAACACACATAAAACAAGG + Intergenic
972165979 4:36284627-36284649 ATAGAAACACACATATAAGTAGG - Intronic
972233127 4:37098424-37098446 ATAGAAACATACATAAAACAAGG - Intergenic
972477458 4:39464481-39464503 ATAGAAACACAACTGAAAAATGG - Intronic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
973712006 4:53639522-53639544 ACAGAAACGTACATTAAACAAGG + Intronic
973745282 4:53957994-53958016 ACAGAAACACACACAAAACAAGG + Intronic
973760638 4:54111957-54111979 ATAGAGACACACATAAAACAAGG - Intronic
974012917 4:56623831-56623853 ATAAAAACATACATGAAACTGGG - Intergenic
974411662 4:61549246-61549268 ATAGAATCATACTGCAAACAGGG + Intronic
974460568 4:62182068-62182090 AGAGAAACACACACAAAGCAAGG - Intergenic
974547017 4:63324914-63324936 ATAGAAATAAGCATAAAACAAGG + Intergenic
974584982 4:63862075-63862097 ATAGAAACACACATGTATCTAGG + Intergenic
974636803 4:64574362-64574384 ATAAAATCACACATTAAAAAGGG - Intergenic
974805530 4:66875219-66875241 ATAGAAATACATATAAAACAAGG - Intergenic
975088210 4:70368602-70368624 AGAGAAAAACACATCATAAAGGG + Intergenic
975115194 4:70672425-70672447 ATAAAAACTCACAGCAAACCAGG - Intronic
975211710 4:71708233-71708255 AGAGACAGACACATCAATCAAGG - Intergenic
975335219 4:73168735-73168757 ACAGAAACACACGTAAAACAGGG - Intronic
975719629 4:77237217-77237239 ATATAAACACAAACCAAACTGGG + Intronic
975814562 4:78204137-78204159 GTAGAAACACACATAAAACAAGG + Intronic
975828070 4:78340561-78340583 ATATAAAGACAAATCAAATATGG + Intronic
975846139 4:78527093-78527115 ACAGAAACAGACATAAAACAAGG + Intronic
975928137 4:79484492-79484514 ATAGAAACACAAATTACACTGGG - Intergenic
976036381 4:80827524-80827546 ATAAAAACACTCAGCAAACTAGG + Intronic
976050524 4:81007280-81007302 ACAAAAACACACATAAAGCAAGG - Intergenic
976252055 4:83062798-83062820 ACAGAAACACACATAAAACAAGG + Intronic
976641711 4:87346231-87346253 ATAAAAACACTCAACAAACTAGG + Intronic
976740346 4:88349913-88349935 ACAGAAACACACATAAAACCAGG - Intergenic
976766182 4:88600407-88600429 ACAGAAACACACATAAAAAAAGG - Intronic
976835929 4:89373925-89373947 ACAGAAACACACACAAAACAAGG + Intergenic
977193082 4:94024559-94024581 ATAAAAACACTCAACAAACTAGG + Intergenic
977857777 4:101914654-101914676 ACAGAAACACACATAAAGCAAGG - Intronic
978181424 4:105800851-105800873 ATAGAAGCACATATAAAATAAGG - Intronic
978389484 4:108210038-108210060 ACAGAAACACATAGGAAACAAGG + Intergenic
978692135 4:111526368-111526390 ATAAAAACCCTCATCAAACTAGG - Intergenic
978786435 4:112615014-112615036 GCAGAAACATACATAAAACAAGG + Intronic
978874862 4:113627472-113627494 ACAGAAACACACATAAAACTAGG - Intronic
978988486 4:115046610-115046632 ACACACACACACATCACACAGGG - Intronic
979186522 4:117802258-117802280 ACAGAATGACACATAAAACAAGG + Intergenic
979586603 4:122426792-122426814 ATAAAAACACTGAACAAACAAGG + Intronic
979594608 4:122520815-122520837 AGACAAAGACACATCAAAAAAGG - Intergenic
980262817 4:130475829-130475851 ATCGAAACAGACACCAAACCGGG - Intergenic
980317555 4:131222173-131222195 ATAAAAACACTCAACAAACTAGG + Intergenic
980689396 4:136274874-136274896 AGAGAAACAAACAGAAAACATGG - Intergenic
980767597 4:137328024-137328046 ATAAAAACCCTCAACAAACAAGG - Intergenic
980823142 4:138041948-138041970 ACAGAAACGCACATAAAATAAGG - Intergenic
980926827 4:139145848-139145870 ATAAAAACACCCAAAAAACAAGG + Intronic
981223639 4:142266192-142266214 ATAGAACTACAAAACAAACAAGG + Intronic
981751677 4:148098233-148098255 ACAGAAACATGCATAAAACAAGG - Intronic
981811894 4:148784798-148784820 ATAGAAAAACAAATCTTACATGG - Intergenic
981918205 4:150057658-150057680 ATAGAGACACACCTGAAACTGGG - Intergenic
982493596 4:156061900-156061922 ATAAATAAACAAATCAAACATGG + Intergenic
982561681 4:156935659-156935681 ACAGAAACACACATAAAATAAGG + Intronic
982631322 4:157832895-157832917 ACAGAAATAAACATAAAACAAGG + Intergenic
982986105 4:162208796-162208818 ATAGAAACACTCAGTAAACTAGG + Intergenic
983322956 4:166217155-166217177 ATTGAAACACAAAGAAAACAAGG - Intergenic
983334030 4:166369433-166369455 ATAAAAACACACAGCAAATTAGG - Intergenic
983473871 4:168191112-168191134 ATAAAAACACTCAACAAACTAGG + Intergenic
983776951 4:171620127-171620149 ATAAAAACCCTCAACAAACAAGG + Intergenic
983916092 4:173292970-173292992 ATAGAAATTCACAACAAAGATGG - Intronic
984186647 4:176552123-176552145 ATAAAAACACTCAACAAACCAGG + Intergenic
984941922 4:184940158-184940180 ATAAAAACAGACATAAATCAAGG - Intergenic
985179746 4:187245721-187245743 ATAAACACCCACATCAAAAATGG - Intergenic
985818472 5:2144237-2144259 CTATAAACAAACAGCAAACAGGG - Intergenic
986406984 5:7436139-7436161 ACAGACGCACACATAAAACAAGG + Intronic
986500524 5:8394017-8394039 ATAAAAGCACTCAGCAAACAAGG + Intergenic
986551453 5:8960692-8960714 ATGTAAGCACAAATCAAACAAGG + Intergenic
986688665 5:10296103-10296125 ACAAAAACACACATAAAACCAGG + Intronic
987401662 5:17484274-17484296 AAAGAAGCCCATATCAAACATGG + Intergenic
988177660 5:27747853-27747875 ATAAAAACCCTCAACAAACAAGG + Intergenic
988179560 5:27772352-27772374 AAACAAACACACAAAAAACATGG + Intergenic
988893158 5:35641853-35641875 ATAGAGAGAGACATCAAAAATGG - Intronic
988935307 5:36076189-36076211 ATAAAAACACTCAACAAACTAGG - Intergenic
988942280 5:36158619-36158641 ATGGAAACAGAAATCAATCAGGG - Intronic
989347329 5:40444430-40444452 ATAAAAACACCCAACAAACTAGG + Intergenic
989691489 5:44150355-44150377 ACAAAAACACACATAAAACAAGG - Intergenic
990017350 5:51080512-51080534 AAAGAAACACACACTAAATATGG - Intergenic
990227865 5:53676408-53676430 ACAAAAACACATATAAAACAAGG - Intronic
990441573 5:55851213-55851235 ACAGAAACACACACAAAACAAGG - Intergenic
990488563 5:56282347-56282369 AAAGACACACATATAAAACAAGG + Intergenic
991708028 5:69378666-69378688 ATAAAAACACATATACAACAAGG - Intronic
992121868 5:73602405-73602427 ATAAAAACACTCAACAAACTAGG - Intergenic
992524060 5:77588769-77588791 ACAAAAACACACATAAAACAAGG - Intronic
992671636 5:79067005-79067027 ATATAAACAACCAACAAACAAGG - Intronic
993472178 5:88319390-88319412 ATCTAAACACACATCAAAACTGG + Intergenic
993722339 5:91334050-91334072 ACAGAAAAACACATAAAACAAGG + Intergenic
994812832 5:104544247-104544269 ATAGAAACACACATAAAAAGTGG - Intergenic
994907945 5:105865226-105865248 GTAAAAACACACAACAAACTAGG + Intergenic
995205027 5:109469819-109469841 AAAGAAACACAACTCAAACTGGG + Intergenic
995418854 5:111939892-111939914 AAAGAAACACATATAAGACAAGG + Intronic
995548411 5:113255539-113255561 ACAGAAACCCAAATCAAACTGGG - Intronic
995915928 5:117244754-117244776 ACAGAAACACACATAAAACAAGG + Intergenic
996011659 5:118487322-118487344 ATAGAAACACACAGATAACCAGG - Intergenic
996048122 5:118899340-118899362 ACAGAAACACATGTAAAACAAGG + Intronic
996171550 5:120298697-120298719 ACAGAAACACACATAAAACAAGG + Intergenic
996592936 5:125168419-125168441 AGAGAAACAAATATAAAACAGGG + Intergenic
996665348 5:126052627-126052649 ACAGAAACAGACACAAAACAAGG + Intergenic
996768332 5:127058431-127058453 ATAGAATCACACATAAAATAAGG + Intronic
996906132 5:128602575-128602597 AGACAAAGACACATCAAAAAAGG - Intronic
997058707 5:130476231-130476253 AAAGAAAAACAAATCAGACATGG - Intergenic
997228969 5:132228942-132228964 ACGGAAATACACATAAAACATGG + Intronic
997606859 5:135181200-135181222 ACAGTAACACACATAAAACAAGG - Intronic
998371234 5:141662940-141662962 ACAGAAAAACACACAAAACAAGG + Intronic
998578846 5:143348807-143348829 ATAGAAACACACATGAAACAAGG + Intronic
999050561 5:148520015-148520037 GCACAAACACACATCAAACAAGG + Intronic
999083238 5:148863957-148863979 ATAGAAGCACAAGTCAAAAATGG + Intergenic
999578202 5:153004545-153004567 ATAGAAATACTCATTAAACGAGG + Intergenic
999732740 5:154487167-154487189 ATAGAATCCCACAGCTAACAAGG - Intergenic
999869194 5:155731485-155731507 AGAGAAACAAACATGAACCAAGG - Intergenic
999915982 5:156261355-156261377 ATACAGACACACACCACACAAGG + Intronic
1000013768 5:157258824-157258846 ACAGAAACATGCATAAAACAAGG + Intergenic
1000020386 5:157313245-157313267 ACAGAAGCACATATAAAACAAGG - Intronic
1000281213 5:159783999-159784021 ATTCAAAGACACATCAAAAAAGG - Intergenic
1000353084 5:160367874-160367896 ATAAGAACACACAACATACATGG - Intronic
1001405329 5:171472705-171472727 ACAGAAACACACATACAACAAGG - Intergenic
1001549160 5:172589776-172589798 ACAGAAACACACATACAACGAGG + Intergenic
1002145633 5:177178711-177178733 TTAAAAACAAACATTAAACAAGG - Intronic
1002388296 5:178887969-178887991 ATAAAAACTCACATCACACTAGG - Intronic
1002417551 5:179128357-179128379 ACAGACTCACACATAAAACAAGG - Intronic
1002567851 5:180122113-180122135 ACATAAGCACACATAAAACAAGG + Intronic
1003471612 6:6440965-6440987 ATAAAAACACTCAACAAACTTGG + Intergenic
1003756188 6:9123280-9123302 AGGGAAACACACATAAAACAAGG + Intergenic
1003834353 6:10053040-10053062 ACAAAAACACTCATCAAACTAGG + Intronic
1004064555 6:12230344-12230366 ACAGAAATACACATAAAACAAGG - Intergenic
1004109581 6:12703345-12703367 ATAGAAGCATACATCAAAAAGGG - Intergenic
1004303386 6:14478352-14478374 ATAGATACAGAATTCAAACATGG - Intergenic
1004792107 6:19038062-19038084 ACACAAGCACACATAAAACAGGG + Intergenic
1005102530 6:22187931-22187953 ACAGAAACACTCATAAAATAAGG - Intergenic
1005132606 6:22527303-22527325 ATAAAAACATATATAAAACAAGG + Intergenic
1005881602 6:30066791-30066813 AGAGAAACCCAGACCAAACAAGG + Intronic
1005967606 6:30738589-30738611 ACAGAAACACATATAAAGCAAGG - Intronic
1006233792 6:32609394-32609416 ATAGTAACACTCATTAAAAAGGG + Intergenic
1006900467 6:37497319-37497341 ACAGAATCACACATGAAACAAGG - Intronic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008169967 6:48192648-48192670 AGAGAAACATACATAAAACAAGG - Intergenic
1008507680 6:52246707-52246729 AAAGAAGCACACAGCAAAGATGG - Intergenic
1008540126 6:52538964-52538986 ACAGAAACACACATAAAACAAGG - Intronic
1008862371 6:56164521-56164543 ATGGAAACAGACAACAAGCATGG + Intronic
1008913783 6:56764549-56764571 CTACAAACAGACATGAAACAAGG - Intronic
1009003961 6:57758227-57758249 AGAGAGACACACCTAAAACAAGG + Intergenic
1009487059 6:64237922-64237944 ATAGTAAAACAAATCATACAAGG + Intronic
1009807723 6:68623984-68624006 AGAGAGACACACACAAAACATGG - Intergenic
1010143940 6:72644240-72644262 ACAGAAACACACATAAAATAAGG - Intronic
1010182955 6:73108994-73109016 GTATATACACACATAAAACATGG - Intronic
1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG + Intronic
1010367559 6:75069391-75069413 ATAAAAACACACAACAAACTTGG - Intergenic
1010564517 6:77393173-77393195 ACATAAAAACACATGAAACAAGG - Intergenic
1011232013 6:85172805-85172827 GCAGAAACACACACCAAATAAGG - Intergenic
1011300757 6:85870921-85870943 ATAGAAACACTCAACAAACTAGG - Intergenic
1011300920 6:85872757-85872779 ATAGAAACACTCAACAAACTAGG - Intergenic
1011450560 6:87487481-87487503 ATTGAAGCACACACAAAACAAGG - Intronic
1011492770 6:87909743-87909765 ATAGAAAGAAAAATCAATCAAGG - Intergenic
1011590350 6:88965220-88965242 GCAGAAACACACATCAGGCAAGG - Intergenic
1011826562 6:91313165-91313187 ATAGAAAAACACAACAGAGATGG - Intergenic
1012130809 6:95489957-95489979 ATATAAATACACATCAAAGGTGG - Intergenic
1012192266 6:96295046-96295068 ATACAAACACTCAACAAACTAGG + Intergenic
1012328391 6:97953058-97953080 ATAAAAACTCACAGCAAACTGGG - Intergenic
1012458627 6:99435232-99435254 ATATAAAAGCACATAAAACACGG + Exonic
1012940899 6:105414331-105414353 ATAGAAACCCTCAAAAAACAAGG + Intergenic
1013013408 6:106140370-106140392 ACAGAAACACACATGGCACAAGG + Intergenic
1013023714 6:106247629-106247651 ACAGAAACACACATAGAACAAGG - Intronic
1013579914 6:111523490-111523512 ATAGAAATATTCATCAAACTTGG - Intergenic
1014245827 6:119067608-119067630 ACAGAAACACACATAAAACAAGG + Intronic
1014556498 6:122847368-122847390 ATAATAACAGACATCAAAGAAGG - Intergenic
1014651423 6:124043526-124043548 ATATAAACTCACAATAAACAAGG + Intronic
1015113727 6:129622127-129622149 ATGGAGACACACATCCTACAGGG + Intronic
1015153394 6:130063584-130063606 ACAGAAACACACATAAAACAAGG - Intronic
1015467798 6:133567322-133567344 AAACAAACAAACATAAAACACGG + Intergenic
1015595476 6:134862124-134862146 ACAGATACACACATAAAACAAGG - Intergenic
1015934815 6:138398260-138398282 GCAGAAACACACATAAAACAAGG + Intergenic
1016198180 6:141372395-141372417 ATATACACACACATAAAATATGG - Intergenic
1016420607 6:143878668-143878690 ACAGAAACATGCATAAAACAAGG + Intronic
1016690752 6:146935086-146935108 ACAGAAATGCACATAAAACAAGG - Intergenic
1017165788 6:151407327-151407349 ATAGAAACAGACATTAAGAAAGG - Intronic
1017207199 6:151816111-151816133 ACAGAAAAACATATAAAACAAGG + Intronic
1017399956 6:154049056-154049078 ACAGAAACACACATAAAACAAGG - Intronic
1017815601 6:158014367-158014389 ATAGAAAAACACATAAAACAAGG + Intronic
1017823118 6:158063065-158063087 ATGGAAACATACATAAAACAAGG + Intronic
1018139296 6:160811977-160811999 CCAGAAACACACACAAAACAAGG - Intergenic
1018306032 6:162456734-162456756 ACAGAAACACACATAAAACAAGG - Intronic
1018558295 6:165073093-165073115 GTAGAAAGAAACATAAAACAGGG + Intergenic
1019225848 6:170507313-170507335 ACAGAAACATACATAAAACAAGG - Intergenic
1019812913 7:3177797-3177819 AGAGAAACACACATAAAGCGGGG - Intergenic
1019946693 7:4335337-4335359 TCAGAAACACACACAAAACAAGG - Intergenic
1020342541 7:7127679-7127701 ATAGAAAGCCAAATCAAAAAAGG - Intergenic
1020380405 7:7538727-7538749 ATAGAAATACACACAAAAAAAGG + Intergenic
1020632422 7:10655379-10655401 ACAAAAATACAGATCAAACATGG + Intergenic
1020771481 7:12401020-12401042 ATAAAAACACTCAACAAACTAGG + Intronic
1021344713 7:19511154-19511176 ATAGAAAGACACACCAATAAAGG + Intergenic
1021357508 7:19670123-19670145 ACAGAAACAAACATATAACAAGG + Intergenic
1021469578 7:20985970-20985992 ACAGAAACACACATAAAACAAGG - Intergenic
1021744946 7:23730722-23730744 ATTGAAACACACATGAATCAAGG + Intronic
1021787669 7:24168332-24168354 AAAGAAAAACTCAGCAAACAAGG + Intergenic
1022180709 7:27916470-27916492 ACAGAAACACACCTAAAACAAGG - Intronic
1022285240 7:28950411-28950433 ATAGAAACATACATAAATTAAGG + Intergenic
1022402577 7:30053900-30053922 ATGAAAACACACATAAAACAAGG - Intronic
1022518314 7:30989351-30989373 ACAGAAACAGACATAAAACAAGG + Intronic
1022518562 7:30990820-30990842 ACAGAAACAGACATGAAACAAGG - Intronic
1023151511 7:37205354-37205376 ACAGAAACACACATAAAAGAAGG - Intronic
1023242729 7:38165535-38165557 ATAAAAACACACAATAAGCAAGG + Intergenic
1023431703 7:40099594-40099616 ATAGAAGCAAAAAGCAAACAAGG - Intergenic
1023433545 7:40118871-40118893 AAAGAAACACAAATCATCCATGG + Intergenic
1023719877 7:43081833-43081855 ACAGAAACACACATAATGCAAGG + Intergenic
1024235954 7:47398632-47398654 ATAAAAACACTCAACAAACTAGG + Intronic
1024784016 7:52885818-52885840 ACAGAGACACACATGAAGCAAGG + Intergenic
1024846506 7:53649957-53649979 ATAAAAAGACACAACATACAAGG - Intergenic
1024873476 7:53993247-53993269 ATAGAGAAACACATAACACAAGG + Intergenic
1024916495 7:54505814-54505836 ATAGAAACACACATAAAACAAGG - Intergenic
1024954866 7:54906834-54906856 ACAGAAACACACATCAAACAGGG - Intergenic
1026232236 7:68495118-68495140 ATAGAAACAAACAAAAAAGAAGG - Intergenic
1026476756 7:70743153-70743175 AAAGAAACAAAAATAAAACAAGG - Intronic
1026696214 7:72594949-72594971 ATAAAAACACTCAACAAAGAAGG + Intronic
1027340732 7:77205309-77205331 ACAGAAACACACTTAAAATAAGG - Intronic
1027401580 7:77814311-77814333 ATAGAAACACATATGAAACAAGG - Intronic
1027409366 7:77898669-77898691 ACAGAAACACACATAAAACAAGG - Intronic
1027815722 7:82967751-82967773 AATGCAACACACATCAATCAGGG - Intronic
1027847198 7:83395870-83395892 ACACAAACACACATAAAAGAAGG + Intronic
1027924291 7:84440725-84440747 AAAGAAACAAACAACAAAAAAGG + Intronic
1028211066 7:88075648-88075670 ATAGAGAGACACATTGAACATGG + Exonic
1028241677 7:88428702-88428724 ATGGAAACATACAGCAAACTAGG + Intergenic
1028343383 7:89750213-89750235 AATGAAACACACATAAAACAAGG - Intergenic
1028809170 7:95064226-95064248 AAAGAAACACACGTGAAACATGG - Intronic
1029047901 7:97650488-97650510 AGAGAAATACATATAAAACAAGG + Intergenic
1029233601 7:99092796-99092818 ACAGAAGCACACATAAAACAAGG + Intronic
1030241085 7:107326115-107326137 ATAAAAACACTCAACAAACTAGG + Intronic
1030424322 7:109354331-109354353 ATAGCAACACAAAACAAAGACGG + Intergenic
1030483126 7:110129587-110129609 ACAGAAACACACACAAAACAAGG + Intergenic
1030767160 7:113424503-113424525 ACAGAAACACACATAAAACAAGG + Intergenic
1031078536 7:117236239-117236261 ATTGAAAAGCACATCAAAAATGG - Intergenic
1032381205 7:131483479-131483501 ACAGAAACACACATAATACGTGG - Intronic
1032479926 7:132238228-132238250 ACAGAAACACACACAAAACAAGG + Intronic
1032568647 7:132975368-132975390 ATAGAAACACATAGCCAAAAAGG + Intronic
1032971856 7:137173934-137173956 ACAGAAACAAACATAAAACAAGG + Intergenic
1033044704 7:137951392-137951414 ACAGAAGCACACATAAAACAAGG + Intronic
1033051635 7:138009712-138009734 ACAGAAACACACATAAAACCAGG - Intronic
1033289899 7:140074779-140074801 ATAGAAAAACACATAAAACAAGG - Intergenic
1033309374 7:140249412-140249434 CTAGAAAAACACATGAAACCAGG - Intergenic
1033380378 7:140811131-140811153 ACAGAAACACACACAAAACAAGG + Intronic
1033650956 7:143343103-143343125 CCAGAAACACACATACAACAAGG - Intronic
1033891898 7:146023652-146023674 ATAAAAACAAAAATGAAACATGG + Intergenic
1033991257 7:147290155-147290177 ACAGAAACACACACAAAACAAGG - Intronic
1034106231 7:148492805-148492827 ACAGAAACACACATAAAACAAGG - Intergenic
1034608052 7:152336200-152336222 ATAGGAACAAACAACAAAAAAGG + Intronic
1034715353 7:153236484-153236506 ACAGAAACAGACATGACACAGGG - Intergenic
1034857440 7:154565160-154565182 AAAGAAAGACACATAAAACAAGG + Intronic
1034906522 7:154952636-154952658 ACAGAAACACACATAAAACAAGG + Intronic
1035036728 7:155900462-155900484 ACAGAAACCCGCATCAGACAAGG + Intergenic
1035038790 7:155912640-155912662 ACAAAAACACAGATGAAACAAGG + Intergenic
1035093788 7:156335388-156335410 ACAGAAACACACACCAAACATGG - Intergenic
1035390243 7:158499233-158499255 ATAGAAATACTCATTTAACAGGG - Intronic
1035588493 8:795248-795270 GCAGAAACACAAATAAAACAAGG - Intergenic
1036083648 8:5588672-5588694 ATAGGGACACGCATGAAACATGG + Intergenic
1036124230 8:6048349-6048371 GCAGAAACACAGGTCAAACATGG + Intergenic
1036390687 8:8321950-8321972 ACAGAAGCATACATGAAACAAGG - Intronic
1036417931 8:8567619-8567641 AAAGAAAAACACATAAAACAAGG - Intergenic
1037278373 8:17206350-17206372 GTAGAAACACACATAAAACAAGG + Intronic
1037631615 8:20662404-20662426 ACAGAAATACACATAGAACAAGG + Intergenic
1037792507 8:21958359-21958381 ACAAAAACACAAATAAAACATGG - Intronic
1037828654 8:22175583-22175605 AAAGAAACACTCATAAAACAAGG - Intronic
1037872977 8:22516962-22516984 ACAGAAACACATCTGAAACAAGG + Intronic
1038143036 8:24866990-24867012 ACAGAAACACACATAAAACAAGG + Intergenic
1038177351 8:25193229-25193251 ACACAAACACACATAAAATAAGG - Intronic
1038278848 8:26144330-26144352 ACAGAAACACACATAAAGCAAGG - Intergenic
1038511553 8:28140917-28140939 ACAGAAACACACATAAAACAAGG + Intronic
1038512678 8:28154216-28154238 ACAGAAACATGCATCAAACAAGG + Intronic
1039155379 8:34549850-34549872 ATAAAAACACTCAACAAACTAGG - Intergenic
1039601394 8:38841146-38841168 ACAGGAACACACGTAAAACAAGG - Intronic
1039772635 8:40703047-40703069 ACAGAAACACACACAAAACAAGG + Intronic
1039813119 8:41067409-41067431 AAAGAAACACAAATCAGACTAGG + Intergenic
1039818047 8:41112050-41112072 AGAGAAACACACATAAAACAAGG - Intergenic
1040115797 8:43617498-43617520 ATAACAGCACGCATCAAACAGGG - Intergenic
1040442944 8:47463820-47463842 ATAAAAACACTCAACAAACTGGG + Intronic
1040780390 8:51100864-51100886 ATTGAAACACTCAACAAACTAGG + Intergenic
1040922530 8:52638162-52638184 ATAAAAACACTCAACAAACTAGG - Intronic
1041244425 8:55877059-55877081 ACAGAAACACACACCATATAAGG - Intergenic
1041288955 8:56290172-56290194 ACAGAAACACACATAAAACAAGG + Intergenic
1041411991 8:57566189-57566211 AAAGCAAAACACAGCAAACAAGG + Intergenic
1041488358 8:58404206-58404228 ACAGAAATAGACATAAAACAAGG + Intergenic
1042205529 8:66326484-66326506 ACAGAAAATCACATAAAACAAGG - Intergenic
1042209498 8:66365624-66365646 ACAGAAACACACATAAAACAAGG + Intergenic
1042296241 8:67221423-67221445 ATAGACACACACATTAACCTAGG - Intronic
1042567567 8:70128065-70128087 ACAGAAACACACATAAAACAAGG + Intronic
1043040258 8:75253771-75253793 ATAAAGACACACATGAAACTGGG + Intergenic
1043098923 8:76014842-76014864 TCAGAAACACACATAAAACAGGG - Intergenic
1043868938 8:85408026-85408048 ATAGAAACATTCAACAAACCAGG + Intronic
1044011381 8:86998188-86998210 ACAGAAACACACACAAAACTAGG - Intronic
1044133322 8:88554503-88554525 AAAGAAGTACACATCAAACCTGG - Intergenic
1044211809 8:89559488-89559510 ACAGAAACACACATTAAACAAGG - Intergenic
1044340631 8:91042217-91042239 AAAGAAAAACATATAAAACATGG - Intergenic
1044471205 8:92570702-92570724 ACAGAAAGACACATAAAACAAGG - Intergenic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1044722323 8:95162362-95162384 ATAGAAAAAAACAGCAAACAGGG + Intergenic
1044748179 8:95391389-95391411 ACAGAAACACACATAAAACAAGG - Intergenic
1044799507 8:95939412-95939434 ACAGAAACACGCAGAAAACAAGG + Intergenic
1044848283 8:96403143-96403165 ACAGAAACACACATAAAATAAGG + Intergenic
1044879020 8:96703056-96703078 AAAGAAGCATACATAAAACAAGG + Intronic
1044918404 8:97141220-97141242 ATCAAAACACACACTAAACAGGG + Intronic
1045008759 8:97938839-97938861 ACAGAAACACACATAAAACAAGG - Intronic
1045218260 8:100171027-100171049 ATAAAAATTCTCATCAAACAAGG - Intronic
1046286777 8:112103599-112103621 ATAAAAACACTCAACAAACTAGG - Intergenic
1046989779 8:120439434-120439456 ACAGAAACACACATAAAACAAGG + Intronic
1047265486 8:123303899-123303921 ATAAAAACACTCAACAAACTAGG - Intergenic
1047437341 8:124845817-124845839 ACAAGAACACACATAAAACAAGG - Intergenic
1048698316 8:137054414-137054436 ACAGAAGCACACCTAAAACAAGG - Intergenic
1048707723 8:137172800-137172822 GAAGAAAGACACATAAAACAGGG + Intergenic
1048901842 8:139045667-139045689 AGATAAACACTCATCTAACATGG + Intergenic
1049117395 8:140701081-140701103 CTTGAAAGACACATAAAACAAGG - Intronic
1049310053 8:141929035-141929057 CTAGAAAAAAACAGCAAACACGG + Intergenic
1050287875 9:4122190-4122212 ATTGAAGCAAACATCTAACATGG - Intronic
1050458505 9:5856753-5856775 TCAGAAACACACATAAAACAAGG - Intergenic
1050488129 9:6156994-6157016 ATAAAAACACTCAACAAACTAGG + Intergenic
1050505491 9:6344328-6344350 ATAAAAACCCACAACAAACTTGG + Intergenic
1050690115 9:8217777-8217799 ATATCAAGACACATTAAACAAGG + Intergenic
1050911434 9:11077009-11077031 ATAAAAACTCTCAACAAACAGGG - Intergenic
1051026504 9:12619085-12619107 ACAGAAACACACATAAAACAAGG - Intergenic
1051427833 9:16951560-16951582 ATAAAAACACTCAACAAACTAGG - Intergenic
1051446749 9:17148411-17148433 ACAGAAACACACATAAAATGAGG - Intronic
1051525767 9:18042659-18042681 AAAGAAACACACACCAAATAAGG - Intergenic
1051570245 9:18548546-18548568 AAAGAAACATACATTAAATAAGG + Intronic
1052333019 9:27289983-27290005 ACAGAAACACACATAAAACAAGG - Intronic
1052620629 9:30904631-30904653 ACAGAAACACATATAAAATAAGG + Intergenic
1052805019 9:33005399-33005421 ATAAAACCACACCTCAAAAATGG - Intronic
1053450593 9:38191247-38191269 ATAGAAACACAAAACAGACTAGG - Intergenic
1054848803 9:69824766-69824788 ACTGAAACACACATAATACAAGG + Intronic
1055232428 9:74082041-74082063 ATAGAAACACTCCACAAACTAGG + Intergenic
1055472408 9:76626063-76626085 ACAGAAACACACATAAAAAAAGG + Intronic
1055579138 9:77689925-77689947 ATACACACACACATAAAATAAGG - Intergenic
1055659523 9:78488929-78488951 AAACAAACCCACATAAAACAAGG - Intergenic
1055737905 9:79352297-79352319 GCAGAAACACACGTAAAACAAGG - Intergenic
1055847051 9:80578188-80578210 ATAAAAACACTCAACAAACTAGG + Intergenic
1056081689 9:83101813-83101835 ACAGAAACACACATAAAACAAGG - Intergenic
1056145806 9:83728214-83728236 ATAGAAACACACATAAAAGAAGG + Intergenic
1056200960 9:84275977-84275999 ATATACACACACTTCAAACCTGG + Exonic
1056274230 9:84977147-84977169 ACAGAAACGTACATAAAACAAGG - Intronic
1056375700 9:86008515-86008537 ACAGAAATACACATAAAATAAGG + Intronic
1056420349 9:86419922-86419944 ACAGAAACACACATAACACAAGG - Intergenic
1056449628 9:86704005-86704027 ATAGAAAAACACATAGAATAAGG + Intergenic
1056544151 9:87599870-87599892 ACAGAAACACACATAAAACAAGG - Intronic
1056701373 9:88913378-88913400 ATAAAAGCTCTCATCAAACAAGG + Intergenic
1056780042 9:89542481-89542503 GGAAACACACACATCAAACAGGG - Intergenic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1056925637 9:90832056-90832078 ATAGAAATACACATAAAACAAGG + Intronic
1057028834 9:91757828-91757850 ACAGAAACACACATAAACCAAGG - Intronic
1057285099 9:93746378-93746400 ATAAAAACACCCAACAAACTAGG - Intergenic
1057340128 9:94193146-94193168 ATAAAAACACTCAACAAACTAGG - Intergenic
1057636038 9:96768172-96768194 ATAAAAACAAACATTTAACATGG + Intronic
1057887009 9:98837465-98837487 ACAGAAACACATAGAAAACAAGG - Intronic
1058344023 9:103937065-103937087 ATAGAAACATATTTAAAACATGG + Intergenic
1058649609 9:107162825-107162847 ATGGAAACACACTTAAAACAAGG + Intergenic
1058721312 9:107767134-107767156 AAAGAAACACACATACATCATGG - Intergenic
1058775110 9:108275385-108275407 ACAGAAGCACACAGAAAACAAGG + Intergenic
1058922915 9:109634691-109634713 ATAGAAACACACATGAGAAGGGG - Intergenic
1059366796 9:113792684-113792706 ATAGTAACAAGCATCACACAAGG + Intergenic
1059788110 9:117608960-117608982 ACAAAAATACACATAAAACAAGG - Intergenic
1060447217 9:123701327-123701349 TAAGAAAGACACATCAAAGAGGG + Intronic
1061296301 9:129678696-129678718 AAAGTCACACACCTCAAACAAGG - Intronic
1061905949 9:133697726-133697748 ATAAAAACGCACAACAAACTAGG + Intronic
1185634419 X:1541067-1541089 ACAGAAACACACGTAAAATAAGG - Intergenic
1185885993 X:3783451-3783473 ACAGAAACACACCTAAAACAAGG + Intergenic
1186057217 X:5662623-5662645 ACAGAAATACACATAAAACAAGG - Intergenic
1186158862 X:6755188-6755210 ACAGAAACACACAGAAAACAAGG + Intergenic
1186334836 X:8574908-8574930 GTAGAAGCAGACAGCAAACAAGG - Intronic
1187025201 X:15428223-15428245 CTTGAAACACACATAAAAGAAGG + Intronic
1187105879 X:16241027-16241049 ATAGAAACAAACATAAGATAAGG + Intergenic
1187124253 X:16438783-16438805 ACAGAAACATATATAAAACAGGG + Intergenic
1187193778 X:17061310-17061332 ATACAAAGACAGATGAAACAGGG + Intronic
1187252860 X:17614603-17614625 AAACAAACACATATCAAGCATGG - Intronic
1187287513 X:17919889-17919911 ACAGAAACACACATAAAACAAGG - Intergenic
1187386636 X:18854869-18854891 ACAGAAACATACACAAAACAAGG + Intergenic
1187796549 X:23010217-23010239 ATAGACACACACACTAACCATGG + Intergenic
1187881519 X:23851912-23851934 ATACATACATACATAAAACAGGG - Intronic
1188607982 X:32057076-32057098 ATAAAAACACACAACAAACTAGG + Intronic
1188799770 X:34514916-34514938 ACAAACACACACAACAAACATGG + Intergenic
1188919971 X:35961037-35961059 ATAGAAACATGCAACAAACTAGG - Intronic
1189080292 X:37963896-37963918 ATAAAAACACTCAACAAACTAGG - Intronic
1189140257 X:38597571-38597593 AAACAAACACATATAAAACAAGG + Intronic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1189459378 X:41225702-41225724 GTAGAAACACACATACAACAAGG - Intronic
1189529093 X:41859789-41859811 ACAGAAGCACACATAAAACAAGG + Intronic
1189559802 X:42180601-42180623 ACAGAAACATACACTAAACAAGG + Intergenic
1189764252 X:44353652-44353674 ATAAAAACACTCAACAAACCAGG + Intergenic
1190257947 X:48778173-48778195 ATAAAAACACTCAACAAACTAGG + Intergenic
1191098764 X:56702372-56702394 ATAGAAACAAGGATCAAACATGG + Intergenic
1191206360 X:57837325-57837347 ATAGAAAACCACAGCATACATGG + Intergenic
1192123612 X:68479736-68479758 TTAGAGACACATATAAAACATGG - Intergenic
1192613746 X:72595248-72595270 ATAAAAACACTCAACAAACTAGG + Intronic
1192687078 X:73318374-73318396 AAAGACACACACATGAAATATGG + Intergenic
1192728665 X:73779672-73779694 ACGGAAACACACATAAAACAAGG - Intergenic
1192771026 X:74190878-74190900 ATAAAAACACTCAACAAACTAGG - Intergenic
1193057340 X:77167736-77167758 ATAAAAACACTCAACAAACTAGG - Intergenic
1193082380 X:77418578-77418600 ACAGAAACACACACAAAACAAGG - Intergenic
1193412925 X:81186076-81186098 AAACAAAGACACATCAAAAAAGG - Intronic
1193463687 X:81820548-81820570 ATAAAAACACTCAGCAAACTAGG + Intergenic
1193628832 X:83854712-83854734 ATAAACAGATACATCAAACAAGG - Intergenic
1194121399 X:89967637-89967659 ATAAAAACCCTCAACAAACAAGG - Intergenic
1194201246 X:90955119-90955141 ATAAAAACACTCAACAAACTAGG - Intergenic
1194211066 X:91069888-91069910 ATAAAAACACTCAACAAACTAGG + Intergenic
1194310299 X:92298326-92298348 TTAGAAACACTCACCAAACTAGG - Intronic
1194356969 X:92897334-92897356 ATAAAAACACTCAACAAACTAGG - Intergenic
1194759389 X:97776390-97776412 ACACACACACACATCACACAGGG - Intergenic
1194786352 X:98088901-98088923 ATAAAAACACTCAACAAACTAGG - Intergenic
1195165116 X:102212149-102212171 AGACAAACACACATCAAAAAAGG - Intergenic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1195193742 X:102474942-102474964 AGACAAACACACATCAAAAAAGG + Intergenic
1195214024 X:102679386-102679408 ATAAAAACACTCACCAAACCAGG - Intergenic
1195309733 X:103620364-103620386 ATAAAAACACACAACAAATGAGG + Intronic
1195366258 X:104128957-104128979 ACAGAAGCATACATAAAACAAGG - Intronic
1195506445 X:105663357-105663379 ATACAAACACAGATCATACATGG + Intronic
1195571011 X:106398714-106398736 ACAAAAACACATATAAAACAAGG + Intergenic
1195631110 X:107056076-107056098 ATAAAAACACTCAGCAAACTAGG - Intergenic
1195714018 X:107800433-107800455 ATAAAAACACTCAACAAACTAGG + Intergenic
1195830545 X:109053877-109053899 ATAGAAACTCTCAACAAACGAGG - Intergenic
1196028227 X:111065237-111065259 ATAAAAACCCACAACAAACTAGG - Intronic
1196187759 X:112762735-112762757 AGAGAAGCACATATCAGACAAGG + Intergenic
1196708126 X:118734500-118734522 ATAAAAACACTCAACAAACTAGG - Intronic
1196772252 X:119306570-119306592 ACAGAAACACATATAACACACGG - Intergenic
1196967123 X:121068672-121068694 TAAGAAATACACATAAAACAAGG + Intergenic
1196980291 X:121205642-121205664 ATAGAATCAGAGATAAAACAAGG - Intergenic
1197027541 X:121772750-121772772 AAAGAAAAACACATCAAGCTAGG - Intergenic
1197484733 X:127034577-127034599 ATAGAAACCCTCAACAAACTAGG + Intergenic
1197731176 X:129811321-129811343 TCAGAAAAACACATCAGACAAGG + Intronic
1197875770 X:131104337-131104359 AGATAAAGACACATCAAAAAAGG - Intergenic
1197903526 X:131398758-131398780 AGAGAAACAGACATCAAGGAAGG + Intronic
1198049644 X:132938271-132938293 AAAGAAACACTCATCAAACTAGG + Intronic
1198971654 X:142288028-142288050 ATAGAAATACTCAACAAACTAGG + Intergenic
1199080961 X:143576476-143576498 ATACACACACACACAAAACATGG + Intergenic
1199231157 X:145437368-145437390 ATGGAAAAATACATAAAACAAGG - Intergenic
1199333953 X:146596692-146596714 AGACAAAGACACATCAAAAAAGG - Intergenic
1199470543 X:148190921-148190943 ATAGAAGCACACAACACATAAGG - Intergenic
1199564183 X:149197068-149197090 ATAAAAACACATAACAAAAAGGG + Intergenic
1200042986 X:153383343-153383365 ATGAAAACACACAACACACATGG + Intergenic
1200474255 Y:3625088-3625110 ATAAAAACCCTCAACAAACAAGG - Intergenic
1200547090 Y:4530575-4530597 ATAAAAACACTCAACAAACTAGG - Intergenic
1200618589 Y:5412612-5412634 TTAGAAACACTCACCAAACTAGG - Intronic
1200664355 Y:6001834-6001856 ATAGAGGGACAAATCAAACAAGG + Intergenic
1201267192 Y:12218975-12218997 TGAGAAACACATGTCAAACAGGG - Intergenic
1201428663 Y:13883340-13883362 GTAGAAGCAGACAGCAAACAAGG + Intergenic
1201787152 Y:17797293-17797315 ATACAAAAACACATCACACATGG + Intergenic
1201814401 Y:18108695-18108717 ATACAAAAACACATCACACATGG - Intergenic
1201912647 Y:19148707-19148729 ACAGACACACACCTAAAACAAGG - Intergenic