ID: 1008130235

View in Genome Browser
Species Human (GRCh38)
Location 6:47712939-47712961
Sequence GATCCTAAGAGGCCACAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 14, 3: 256, 4: 584}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008130235_1008130241 3 Left 1008130235 6:47712939-47712961 CCGGGCTGTGGCCTCTTAGGATC 0: 1
1: 0
2: 14
3: 256
4: 584
Right 1008130241 6:47712965-47712987 GCTACACAGCAGGAGGTGAGCGG 0: 20
1: 568
2: 850
3: 725
4: 720
1008130235_1008130242 6 Left 1008130235 6:47712939-47712961 CCGGGCTGTGGCCTCTTAGGATC 0: 1
1: 0
2: 14
3: 256
4: 584
Right 1008130242 6:47712968-47712990 ACACAGCAGGAGGTGAGCGGAGG 0: 37
1: 316
2: 744
3: 693
4: 776
1008130235_1008130243 7 Left 1008130235 6:47712939-47712961 CCGGGCTGTGGCCTCTTAGGATC 0: 1
1: 0
2: 14
3: 256
4: 584
Right 1008130243 6:47712969-47712991 CACAGCAGGAGGTGAGCGGAGGG 0: 12
1: 226
2: 1169
3: 1438
4: 1278
1008130235_1008130240 -4 Left 1008130235 6:47712939-47712961 CCGGGCTGTGGCCTCTTAGGATC 0: 1
1: 0
2: 14
3: 256
4: 584
Right 1008130240 6:47712958-47712980 GATCTGGGCTACACAGCAGGAGG 0: 1
1: 19
2: 390
3: 858
4: 1394
1008130235_1008130239 -7 Left 1008130235 6:47712939-47712961 CCGGGCTGTGGCCTCTTAGGATC 0: 1
1: 0
2: 14
3: 256
4: 584
Right 1008130239 6:47712955-47712977 TAGGATCTGGGCTACACAGCAGG 0: 1
1: 19
2: 439
3: 863
4: 1396
1008130235_1008130245 29 Left 1008130235 6:47712939-47712961 CCGGGCTGTGGCCTCTTAGGATC 0: 1
1: 0
2: 14
3: 256
4: 584
Right 1008130245 6:47712991-47713013 GTGAGCGAACATTATCACCTGGG 0: 1
1: 0
2: 2
3: 2
4: 42
1008130235_1008130244 28 Left 1008130235 6:47712939-47712961 CCGGGCTGTGGCCTCTTAGGATC 0: 1
1: 0
2: 14
3: 256
4: 584
Right 1008130244 6:47712990-47713012 GGTGAGCGAACATTATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008130235 Original CRISPR GATCCTAAGAGGCCACAGCC CGG (reversed) Intronic
900477459 1:2882606-2882628 GATCCTATGAGGCCTCTGCTGGG + Intergenic
900711319 1:4116424-4116446 GTTCCTAATGGGCCACAGACTGG + Intergenic
901323520 1:8353517-8353539 GATCGGAAGAGGCCACGTCCTGG + Exonic
901472608 1:9468103-9468125 AGTCCTAAGAGGCCACAGGATGG + Intergenic
902072748 1:13754704-13754726 CATCCTCAGACACCACAGCCAGG - Intronic
902376047 1:16030337-16030359 AATTGTAAGAGGCCACAGCCTGG - Intronic
902380984 1:16052081-16052103 ATTTGTAAGAGGCCACAGCCTGG - Intronic
902592710 1:17486407-17486429 GTTCCTAACAGGCCACAGACAGG - Intergenic
902600127 1:17535381-17535403 GTTCCTAACAGGCCACAGCCTGG + Intergenic
902803830 1:18848539-18848561 GTTCCTAACAGGCCACAGACTGG - Intronic
903085588 1:20854930-20854952 AATGCTAACAAGCCACAGCCAGG + Intronic
903442925 1:23401791-23401813 GTTCCTAACAGGCCACAGACTGG - Intronic
903654856 1:24942947-24942969 GCTCCTGAGAGGTCACAGGCTGG + Intronic
903703827 1:25270325-25270347 GTTCCTAACGGGCCACAGCCTGG - Intronic
903723416 1:25422999-25423021 GTTCCTAACGGGCCACAGCCTGG + Intronic
904409637 1:30317696-30317718 TCTCCTCAGAGGCCCCAGCCAGG + Intergenic
905206480 1:36345504-36345526 GAGCCTAGGATGACACAGCCTGG - Intronic
905378108 1:37538803-37538825 GTTCCTAACAGGCCACGGACTGG - Intronic
905485909 1:38296423-38296445 GAGCCATTGAGGCCACAGCCTGG - Intergenic
905688917 1:39928411-39928433 GTTCCTAACAGACCACAGACCGG - Intergenic
905763581 1:40581404-40581426 GTTCCTAACAGGCCACAGACTGG - Intergenic
907057455 1:51383661-51383683 GTTCCTAACAGGCCACAGACTGG + Intronic
907127402 1:52063047-52063069 GTTCCTAACAGGTCACAGACTGG + Intronic
907222686 1:52918877-52918899 GTTCCTAGCAGGCCACAGACTGG - Intronic
907257375 1:53190256-53190278 GATCCTAACACGCCACTGACAGG - Intergenic
907866574 1:58404953-58404975 AAGCCTAATAGGGCACAGCCGGG - Intronic
907892198 1:58647024-58647046 GCTCCTAACAGGCCACGGACTGG + Intergenic
907911176 1:58828096-58828118 GTTCCTAACAGGCCACAGATGGG - Intergenic
908155134 1:61345537-61345559 GTTCCTAACAGGCCACTGACTGG - Intronic
908172183 1:61516297-61516319 GTTCCTAACAGGCCACAGACTGG - Intergenic
908309032 1:62857145-62857167 GTTCCTAACAGGCCACAGACTGG - Intronic
908343399 1:63205874-63205896 GTTCTTAACAGGCCACAGACTGG - Intergenic
908588689 1:65604670-65604692 GTTCCTAAGAGGCCACAGACAGG - Intronic
908831704 1:68185435-68185457 GTTCCTAACAGGCCACTGACTGG - Intronic
909221601 1:72969310-72969332 GTTCCTAACAGGCCACAGACAGG + Intergenic
909449018 1:75777986-75778008 GAACCTGAGAGGCAGCAGCCTGG + Intronic
910953744 1:92679004-92679026 GTTCCTAACAGGCCACAGACTGG - Intronic
911150611 1:94594154-94594176 GTTCCTAACAGGCCACGGACCGG - Intergenic
912216412 1:107618189-107618211 GTTCCTAACAGGCCACAGTCTGG + Intronic
913325021 1:117620604-117620626 GTTCCTAACAGGCCACGGACTGG - Intronic
913554624 1:119952715-119952737 GTTCCTAACAGGCCACACACAGG + Intronic
914335776 1:146713962-146713984 GTTCCTAACAGGCCACAAACTGG - Intergenic
915662825 1:157417940-157417962 GACCCTAAGAGGCCACAGGTGGG + Intergenic
916303573 1:163303695-163303717 GTTCCTAACAGGCCACAGACCGG - Intronic
916888859 1:169097191-169097213 TATCCTATGAGACCACTGCCTGG + Intergenic
917098947 1:171426786-171426808 GTTCCTAACAGGCCACAGACTGG + Intergenic
917231891 1:172846396-172846418 GTTCCTAACAGGCTACAGACTGG - Intergenic
917543708 1:175940207-175940229 GTTCCTAACAGGCCACGGACTGG + Intergenic
917562674 1:176175630-176175652 GTTCCTAATAGGCCACAGACTGG + Intronic
918287556 1:183072640-183072662 GTTCCTAACAGGCCACAGACTGG - Intronic
918555639 1:185796322-185796344 GTTCCTAAGAGGCCACGGACTGG + Intronic
918576582 1:186068136-186068158 GTTCCTAATAGGCCACAGGCTGG + Intronic
918699406 1:187589244-187589266 GTTCCTAACAGGTCACAGACAGG - Intergenic
918736636 1:188072072-188072094 GATCCTAAGAAACTACAGCTTGG - Intergenic
919099061 1:193071238-193071260 GTTCCTAACAGGCCACGGACTGG + Intronic
919515853 1:198521883-198521905 GTTCCTAACAAGCCACAGACAGG - Intergenic
919811543 1:201411948-201411970 GTTCCTAACAGGCCACGGACAGG + Intronic
919996605 1:202757265-202757287 GTTCCTAACAGGCCACCGACTGG + Intronic
920737494 1:208546441-208546463 GCTCCTAAGAGACCACATACAGG + Intergenic
922031171 1:221800974-221800996 GTTCCTAACAGACCACAGACAGG - Intergenic
922329349 1:224560424-224560446 GTTCCTAACAGGCCACAGAGTGG - Intronic
923456450 1:234169438-234169460 GAGCCTGGGAGCCCACAGCCGGG - Intronic
923618421 1:235557090-235557112 GTTCCTAACAGGCCACAGACTGG + Intronic
923704427 1:236332526-236332548 GTTCCTAACAGGCCACAGACTGG - Intergenic
923807455 1:237273394-237273416 GTTCCTAAGGGGCCACTGACTGG + Intronic
924030179 1:239878508-239878530 GTTCCTAACAGGCCACAGACTGG + Intronic
924072723 1:240298504-240298526 GTTCCTAACAGGCCACAGAATGG - Intronic
924172993 1:241360398-241360420 GATCCAAAGAGGCAGTAGCCAGG + Intergenic
924770386 1:247074829-247074851 GATCCTAACAGGCCACCGACAGG + Intronic
1063356365 10:5402617-5402639 GTTCCTAACAGGGCACAGACTGG - Intronic
1064104415 10:12489249-12489271 GTTTCTAACAGGCCACAGACTGG + Intronic
1064119930 10:12609743-12609765 GTTTCTAACAGGCCACAGACTGG + Intronic
1064473446 10:15661077-15661099 GCTCCCAACAGGCCACAGACAGG - Intronic
1065307317 10:24381389-24381411 TTTCCTAACAGGCCACAGACTGG - Intronic
1065368398 10:24956778-24956800 GTTCCTAACAGGCCACAGGCTGG - Intergenic
1065383054 10:25109344-25109366 AAACATAAGAGGCCACAGCCTGG + Intergenic
1065505756 10:26428682-26428704 GTTCTTAAGAGGCCACGGACTGG - Intergenic
1065666142 10:28063541-28063563 GTTCCTAACAGGCCACAGACTGG - Intronic
1065905340 10:30245953-30245975 GATTCTCAGAGGCCCCAGCTAGG - Intergenic
1066199536 10:33131812-33131834 GTTCCTAACAGGCTACAGACTGG + Intergenic
1066252712 10:33649940-33649962 AAACCTAAGAGGCCACAACTGGG - Intergenic
1067139228 10:43642435-43642457 GTTCCTAACAGGCCACAGACTGG - Intergenic
1067250952 10:44586919-44586941 GTTCCTAACAGGCCACGGACTGG - Intergenic
1068036843 10:51770520-51770542 GTTCCTAAGAGGCTACGGGCTGG - Intronic
1068163531 10:53299036-53299058 GTTCCTACCAGGCCACAGACTGG + Intergenic
1068544294 10:58328518-58328540 GTTCCTAACAGGCCACAGACTGG + Intergenic
1068603361 10:58978709-58978731 GATCCTAATGGGCCACGGACAGG + Intergenic
1068630066 10:59289286-59289308 GGTCCTAACAGGCTACAGGCCGG + Intronic
1068676335 10:59773404-59773426 GTTCCTAACAGGCCACAGATGGG - Intergenic
1069136470 10:64772918-64772940 GTTCCTAACAGGCCACAGACTGG - Intergenic
1069372237 10:67760588-67760610 GTTCCTAACAGGCCACGGACCGG - Intergenic
1070663708 10:78328647-78328669 GCTCCTAAGAGCCAACTGCCTGG - Intergenic
1071305339 10:84294519-84294541 CATCATATGAGGACACAGCCAGG + Intergenic
1071318594 10:84428465-84428487 GCTCCTAACAGACCACAGACTGG + Intronic
1072172321 10:92877354-92877376 GCTTCTAAAAGGCCAGAGCCAGG - Intronic
1072716133 10:97753760-97753782 GATCCTAGGAACCCACAGCGTGG - Intronic
1072990428 10:100187106-100187128 GTTCCTAACAGGCCACTGTCTGG + Exonic
1073146715 10:101286005-101286027 GTGCCTAGGAGGCCACAGGCAGG - Intergenic
1073276454 10:102315745-102315767 GTTCCTAATGGGCCACAGACTGG + Intronic
1074139609 10:110660440-110660462 GTTCCTAACAGGCCACAGCCTGG - Intronic
1075102654 10:119517203-119517225 GATCCTGAGAAGCCACGGCCTGG + Intronic
1075237323 10:120742501-120742523 GTTCCTAACAGGCCACGGACTGG - Intergenic
1075917638 10:126182911-126182933 GTTCCTAACAGGCCACGGACAGG - Intronic
1076201370 10:128561271-128561293 GCTCCTAACAGGCCACTGACTGG + Intergenic
1076300015 10:129418890-129418912 GATCCCCCGGGGCCACAGCCAGG - Intergenic
1076496933 10:130903680-130903702 CATCCGAGGAGGCCACAGCAAGG + Intergenic
1076621200 10:131789221-131789243 GCTCCTAACAGGCCACAGACTGG - Intergenic
1077448116 11:2612130-2612152 GTTTCTAATAGGCCACAGACTGG - Intronic
1077466042 11:2734243-2734265 GGTCCTAAGAGGCCTCAGGCCGG + Intronic
1078097278 11:8307756-8307778 GTTCCTAACAGACCACAGACTGG - Intergenic
1078116996 11:8463470-8463492 GTTCCTAACAGGCCACGGACAGG + Intronic
1078174083 11:8955743-8955765 GTTCCTAACAGACCACAGACTGG + Intronic
1078292335 11:10025333-10025355 GACCATAAAAGGCCACAGCCTGG - Intronic
1078734518 11:14007741-14007763 GCTCCTAACAGGCCACAGACTGG + Intronic
1078812660 11:14783889-14783911 GTTCCTAACAGGCCACAGACCGG - Intronic
1078949705 11:16116719-16116741 GTTCCTAACAGGCCACAACCTGG - Intronic
1079704384 11:23595684-23595706 TATCCTAAGAGGGGACAGTCAGG + Intergenic
1079870428 11:25792300-25792322 GTTCCCAACAGGCCACAGACTGG - Intergenic
1080466458 11:32502112-32502134 GCTCCTAATAGGCCACAGATGGG - Intergenic
1080471499 11:32550308-32550330 GTTCCTAACAGGCCACAGATCGG - Intergenic
1080512405 11:32987961-32987983 GTTGCTAACAGGCCACAGACTGG - Intronic
1080884483 11:36353819-36353841 ATTCCTAACAGGCCACAGACTGG + Intronic
1081263659 11:40991937-40991959 GTTCCTAAGAGGCCACCAACTGG + Intronic
1081294180 11:41365049-41365071 GTTCCTAACAGGCCACAAACTGG - Intronic
1081552531 11:44127316-44127338 GCTCCAAACAGGCCACAGCCCGG - Intronic
1082740837 11:56909236-56909258 GTTCCTAACAGACCACAGACTGG + Intergenic
1083149701 11:60784066-60784088 GTTCCTAACAGGCCACAGACTGG - Intergenic
1084031282 11:66482117-66482139 GATCATAAGAGTTCAGAGCCAGG + Intronic
1084116058 11:67043584-67043606 GGGCCTGAGAGGCCACAGCAGGG - Intronic
1084330344 11:68426265-68426287 GATCCTGTGTGGCCTCAGCCAGG + Intronic
1084732843 11:71084484-71084506 GAGCCTGCGCGGCCACAGCCAGG - Intronic
1085382710 11:76134884-76134906 GTTCTTAACAGGCCACAGACGGG - Intronic
1085723396 11:78932911-78932933 GTTCCTAACAGGCCACGGTCCGG + Intronic
1087812485 11:102623290-102623312 GTTCCTAACAGGCCACAGACTGG - Intronic
1087854811 11:103078994-103079016 GTTTCTAACAGGCCACAGGCTGG - Intronic
1088341463 11:108772642-108772664 GTTCCTAACAGGCCACAGACCGG - Intronic
1088472191 11:110198455-110198477 GTTCCTAACAGGCCACACGCCGG - Intronic
1088536403 11:110866630-110866652 GAGCCTGAGTGGCCTCAGCCTGG - Intergenic
1089095137 11:115913793-115913815 GTTCCTAACAGGCCACAGACTGG - Intergenic
1089101323 11:115965112-115965134 GTTCCTAACAGGCCACAGACTGG + Intergenic
1090406213 11:126477109-126477131 CAGCCTAAGAGGCCACAGCGCGG + Intronic
1090901646 11:131037568-131037590 GTTCCTAACAGGCCACAGACCGG + Intergenic
1091447293 12:551305-551327 GAGCTTAAGAAGCCTCAGCCAGG - Intronic
1091455475 12:604335-604357 GAGCAATAGAGGCCACAGCCTGG + Intronic
1091513986 12:1159466-1159488 GTTCCTAACAGGCCACAGACCGG + Intronic
1091858243 12:3756105-3756127 CACCCTAAGAGGCCACTGCTAGG + Intronic
1092110606 12:5960868-5960890 GTTCCTAACAGGCCACTGACCGG - Intronic
1092194909 12:6543299-6543321 GTTCCTAACAGGCCACAGACAGG - Intronic
1092392308 12:8091679-8091701 GTTTCTAACAGGCCACAGACTGG + Intronic
1092482602 12:8873907-8873929 GATCCTAAGAAGAAAGAGCCAGG + Intronic
1094066185 12:26363035-26363057 GTTCCTAACAGGCCACAGACTGG - Intronic
1094075156 12:26464510-26464532 GTTCCTAACAGGCCACAGACTGG + Intronic
1094645773 12:32322576-32322598 GTTCCTAATAGGCCACAAACTGG + Intronic
1094689181 12:32751866-32751888 GTTCCTAACAGGCCACGGACTGG + Intronic
1095177595 12:39111100-39111122 GTTCCTAACAGGCCACAGACTGG - Intergenic
1095184096 12:39180696-39180718 GTTCCTAACAGGCCATAGACTGG + Intergenic
1095203080 12:39408414-39408436 GTTCCTAGCAGGCCACAGACTGG + Intronic
1095654333 12:44650979-44651001 GTTCCTAACAGGCCACAGACTGG - Intronic
1095695827 12:45143010-45143032 ATTCCTAACAGGCCACAGACTGG + Intergenic
1095863929 12:46950899-46950921 GAACTTAAGATGCCAAAGCCAGG - Intergenic
1095914830 12:47467240-47467262 GTTCCTAACAGGCCACAGACTGG + Intergenic
1096341111 12:50800501-50800523 GTTCCTAATAGGCCACAGACAGG - Intronic
1096431713 12:51549748-51549770 GTTCCTAACAGGCCACAGACAGG - Intergenic
1097050093 12:56217641-56217663 GTTCCTGATAGGCCACAGTCTGG - Intronic
1097580896 12:61455034-61455056 GTTCCTAACAGGCCACAGCTTGG + Intergenic
1097748295 12:63324116-63324138 GTTTCTAATAGGCCACAGACTGG - Intergenic
1097809938 12:64007508-64007530 GTTCCTAACAGGCCACGGACTGG + Intronic
1098314402 12:69178000-69178022 GTTCCTAACAGGCCAGAGACTGG + Intergenic
1098658020 12:73057573-73057595 GGTCCTACCAGGCCACAGACTGG - Intergenic
1099195293 12:79608522-79608544 GCTCCTAACAGGCCACAGACAGG + Intronic
1099317776 12:81106107-81106129 GTTCCTAACAGGCCACAGACTGG - Intronic
1099871614 12:88356478-88356500 GCTCCTAATAGGCCACAGACTGG - Intergenic
1100140296 12:91610449-91610471 GATCAGAAGAAGCCACGGCCAGG - Intergenic
1100230824 12:92605255-92605277 GTTCCTAACAGGCCATAGACTGG - Intergenic
1100341594 12:93684495-93684517 GTTCCTAATAGGCCACGGACCGG + Intronic
1100386694 12:94110434-94110456 GATCCTAATAGGCCACAAACTGG - Intergenic
1100456862 12:94760126-94760148 GTTCCTAACAGGCCACAGATCGG + Intergenic
1100547822 12:95620197-95620219 GTTCCTAACAGACCACAGACCGG + Intergenic
1100688431 12:97012036-97012058 GTTCCTAACAGGCCAAAGACTGG - Intergenic
1101182456 12:102234064-102234086 GTTCTTAAGAGACCACAGACCGG - Intergenic
1101374213 12:104157008-104157030 GTTCCTAACAGGCCACAGGCTGG + Intergenic
1101399005 12:104372299-104372321 GTTCCTAACAGGCCACAGAGCGG + Intergenic
1101658094 12:106742012-106742034 GTTCCTAACAGGCCACGGTCCGG + Intronic
1101976709 12:109365842-109365864 GTTCCTAACAGGCCACGGACCGG - Intronic
1102431396 12:112886567-112886589 GTTCCTAACAGGCCACAGACTGG + Intronic
1102601733 12:114036629-114036651 CTTCCTAACAGGCCACAGACTGG - Intergenic
1102742365 12:115219301-115219323 GATCCTAAGGGACCACAGTCTGG + Intergenic
1103161351 12:118731899-118731921 GTTCCTAACAGACCACAGACTGG - Intergenic
1103214292 12:119189725-119189747 GTTCCTAACAGGCCACAGATGGG + Intronic
1103865344 12:124047324-124047346 GTTCCTAACAGGCCAAAGACAGG - Intronic
1104246816 12:127050992-127051014 GCTCCTAACAGGCCACAAACTGG - Intergenic
1104466122 12:128992393-128992415 GTTCCTAACAGGCCACAGGCCGG + Intergenic
1104538479 12:129640716-129640738 GCTCCTAACAGGCCACAGACTGG - Intronic
1104702311 12:130916290-130916312 GATTCTGAGAGGCGGCAGCCCGG - Intergenic
1104722227 12:131050960-131050982 GTTCCTAACAGGCCACGGGCTGG + Intronic
1104958591 12:132477583-132477605 GATCCCAAGAGGACACACCCAGG - Intergenic
1104958599 12:132477616-132477638 GATCCCAAGAGGACACACCCAGG - Intergenic
1105064254 12:133182933-133182955 GTTCCTAACAGACCACAGACTGG - Intronic
1105373333 13:19819960-19819982 GTTCCTAACAGGCCACAGCCAGG + Intergenic
1105428311 13:20314828-20314850 GACCCTAGGAGGTCCCAGCCTGG - Intergenic
1105669841 13:22600829-22600851 GATTCTAACAGGCCACAGGCTGG + Intergenic
1106457153 13:29937440-29937462 GTTCCTAACAGGCCACAGACTGG - Intergenic
1106658314 13:31771261-31771283 GTTCCTAACATGCCACAGACTGG - Intronic
1106832743 13:33602649-33602671 GTTCCTAACAGGCCACAGACCGG - Intergenic
1106975259 13:35204023-35204045 GTTCCTGACAGGCCACAGACCGG - Intronic
1106999059 13:35522614-35522636 GTTCCTAAAAGGCCATAGACTGG - Intronic
1107164946 13:37272998-37273020 GATACTAAGATGCTACAGTCAGG - Intergenic
1107357046 13:39578710-39578732 TATGCTAAGAGGCCACAGTCGGG + Intronic
1107515772 13:41127443-41127465 GTTCCAAACAGGCCACAGACTGG + Intergenic
1107599991 13:42003563-42003585 GAACATAAAAGGCCACAGCTGGG + Intergenic
1107749568 13:43550189-43550211 GTTCCTAACAGGCCACAAACTGG + Intronic
1107797217 13:44065085-44065107 GTTCCTAACAGGCCACGGGCTGG + Intergenic
1108377983 13:49830870-49830892 GTCCCTAAGAGCCTACAGCCAGG - Intergenic
1108608210 13:52061334-52061356 GTTCCTAACAGGCCACAGACTGG + Intronic
1108845146 13:54669326-54669348 GTTTCTAAGAGTCCACAGACTGG - Intergenic
1109282260 13:60370591-60370613 GTTCCTAACAGGACACAGACTGG + Intergenic
1109808206 13:67471356-67471378 AATCCTAAGCAGCTACAGCCTGG - Intergenic
1109830549 13:67781425-67781447 GTTCCTAACAGGCCACGGACTGG + Intergenic
1110077725 13:71269887-71269909 GTTCCTAACAGGCCACGGACAGG + Intergenic
1110419071 13:75284575-75284597 GTTCATAACAGGCCACAGACAGG + Intergenic
1110726491 13:78830982-78831004 AATCCTATCAGACCACAGCCAGG - Intergenic
1111183747 13:84701719-84701741 GTTCCTAATAGGCAACAGACTGG + Intergenic
1111694080 13:91601468-91601490 GTTCCTAACAGGCCACGGACTGG - Intronic
1112032999 13:95474426-95474448 GTTCCTAACAGGCCACAGACTGG + Intronic
1112493314 13:99885885-99885907 TATCCCAGGAGGCCACAGCTGGG + Intronic
1112562377 13:100526026-100526048 GCTTCTAAGAGGACACGGCCAGG + Intronic
1112917125 13:104565445-104565467 GTTTCTAACAGGCCACAGACTGG + Intergenic
1113973364 13:114207676-114207698 GTTCCTAACAGGCCACAGACTGG + Intergenic
1114274087 14:21125989-21126011 GTTCCTAACAGGCCACCGACTGG - Intergenic
1114373289 14:22113646-22113668 GTTCCTAACAGGCCACAGAATGG + Intergenic
1114693594 14:24607156-24607178 GATCCAAAGAAGACACAGACCGG - Exonic
1115275964 14:31608816-31608838 GTTTCTAACAGGCCACAGACTGG + Intronic
1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG + Intergenic
1116040439 14:39679939-39679961 GATCCACAGAAGCCTCAGCCAGG - Intergenic
1116574535 14:46556207-46556229 GTTCCTAATAGGCCATAGACTGG + Intergenic
1117554406 14:56869833-56869855 GGTCCTAACAGGCCACAGACTGG - Intergenic
1117574969 14:57088516-57088538 GTCCCTAACAGGCCACAGACTGG - Intergenic
1117581108 14:57152630-57152652 GTTCCTAATAGGCCACGGACTGG - Intergenic
1117706496 14:58475139-58475161 GTTCCTAACAGGCCACAGACTGG - Intronic
1118142089 14:63095077-63095099 GCTCCTAACAGGCCACAGACTGG + Intronic
1118513798 14:66505644-66505666 GTTCCTAATAGGCCACAGATGGG - Intergenic
1119062081 14:71485309-71485331 GTTCCCAAGAGGCCACAGACTGG - Intronic
1119121606 14:72084355-72084377 GTTCCTAACAGGCCACAGACTGG + Intronic
1120141033 14:80929892-80929914 GTTCCTAACAGGCCACGGACTGG - Intronic
1120618755 14:86737319-86737341 ATTCCTAATAGGCCACAGACTGG - Intergenic
1120810924 14:88802721-88802743 GTTCCTAACAGGCCACAGATGGG - Intergenic
1120949291 14:90026303-90026325 TTTCCCAGGAGGCCACAGCCGGG + Intronic
1121078121 14:91085928-91085950 GTTCCTAAGAGGCCACAAACTGG - Intronic
1121149180 14:91615124-91615146 GTTCCTAACAGTCCACAGACTGG - Intronic
1121170552 14:91850420-91850442 GTTCCTAATAGGCCACAGGCTGG - Intronic
1121500910 14:94436692-94436714 GTTCCTAACAGGCCACGGACTGG - Intergenic
1121774989 14:96584543-96584565 GATACTAACTGACCACAGCCTGG + Intergenic
1122833632 14:104420037-104420059 GTTCCTAACAGGCCACGGACTGG - Intergenic
1122833696 14:104420661-104420683 GTTCCTAACAGGCCACGGACTGG - Intergenic
1202894242 14_KI270722v1_random:188910-188932 GTTCCTCACAGGCCACAGACTGG - Intergenic
1124096842 15:26656522-26656544 GTTCCTAACAGGCCACGGACTGG - Intronic
1124472191 15:29997811-29997833 GATGATGAGAGGCCACAGACAGG - Intergenic
1124917823 15:33994091-33994113 GTTCCTAACAAGCCACAGACCGG - Intronic
1125249053 15:37678344-37678366 GTTCCTAACAGGCCACAGACTGG + Intergenic
1125375869 15:39028824-39028846 GTTCCTAACAGGCCACAGACCGG - Intergenic
1125643539 15:41251495-41251517 GTTCCTAACTGGCCACAGACTGG - Intronic
1126344383 15:47677144-47677166 GTTCCTAACAGGCTACAGACTGG + Intronic
1126457022 15:48874382-48874404 GTTCCTAACAGGCCACGGACTGG - Intronic
1126661843 15:51040000-51040022 GTTCCTAACAGGCCACGGACCGG - Intergenic
1126911512 15:53422007-53422029 GTTCCTAACAGGCCACAGACTGG - Intergenic
1127008562 15:54597236-54597258 GTTCCTAACAGGCCACAGACCGG + Intronic
1127077069 15:55337358-55337380 GTTCCTAAGAGGCCATGGACTGG - Intronic
1127339075 15:58022013-58022035 CATCATCAGTGGCCACAGCCTGG - Intronic
1127379066 15:58413363-58413385 GTTCCTAACAGGCCACACACTGG - Intronic
1127441836 15:59016742-59016764 GTTCCTAATAGGCCACAGATGGG - Intronic
1127550855 15:60036997-60037019 GTTCCTAAGAGGCCATGGACCGG + Intronic
1127809502 15:62551262-62551284 GTTCCTAACAGGGCACAGACTGG + Intronic
1127901055 15:63341294-63341316 GTTCCTAACAGGCCACAGACCGG - Intronic
1128082340 15:64864142-64864164 GAGCCTCAGAGGCCCCAGCAGGG - Intronic
1129499462 15:76022119-76022141 GTTCCTAATAGGCCACAGTCTGG + Intronic
1129880404 15:79002990-79003012 GATCCGAACAGGCCACATCTTGG - Intronic
1131810581 15:96169048-96169070 GTTCCTAACAGGCCACAGATTGG - Intergenic
1132033359 15:98457536-98457558 GCTCCTAACAGGCCACAGACTGG + Intronic
1132072740 15:98793819-98793841 CATCCTAAGAGGGAACACCCTGG + Intronic
1133119986 16:3600304-3600326 GTTCCTAACAGGCCACAGACCGG + Intronic
1133660343 16:7910353-7910375 GTTCCTAACAGGCCACAGCTGGG + Intergenic
1133967958 16:10545364-10545386 GTTCCTAACAGGCTACAGACAGG - Intronic
1134689244 16:16180218-16180240 GTTCCTAACAGGCCACAGACTGG + Intronic
1134690236 16:16186385-16186407 GTTCCTAAGAGGCTGCAGACTGG - Intronic
1136060940 16:27726011-27726033 GTTCCTAACAGGCCACAGACTGG - Intronic
1136614601 16:31390083-31390105 ATGCCTTAGAGGCCACAGCCAGG - Intergenic
1136624217 16:31451929-31451951 GAGCCAAAGAGGCCTCTGCCGGG - Intergenic
1137575807 16:49599513-49599535 GATCCCAAGACCCCAGAGCCAGG + Intronic
1137836641 16:51598448-51598470 GTTCCTAAGAGGCCACAGACTGG + Intergenic
1138313697 16:56050145-56050167 GTTCCTAACAGGCCACAAACCGG - Intergenic
1139305861 16:65985929-65985951 GTTCCTAACAGGCCACAGACTGG - Intergenic
1139964700 16:70738901-70738923 GGGTCTAAGAGGTCACAGCCAGG + Intronic
1139997848 16:70997266-70997288 GTTCCTAACAGGCCACAAACTGG + Intronic
1140163322 16:72522565-72522587 GTTCCTAACAGGTCACAGACTGG + Intergenic
1140338699 16:74136459-74136481 GTTCCTAACAAGCCACAGACTGG + Intergenic
1140920337 16:79531792-79531814 GTTCCTAAGAGGCCACAGACTGG + Intergenic
1141043642 16:80694307-80694329 GTTCCTAACAGGCCACGGCCTGG + Intronic
1141107109 16:81242766-81242788 GTTCCTAACAGGCTACAGACTGG - Intronic
1141216089 16:82025176-82025198 GTTCCTAACAGGCCACAGACTGG + Intergenic
1141459955 16:84172270-84172292 CACCCTCAGTGGCCACAGCCTGG - Exonic
1143634820 17:8158516-8158538 GATACTAAGATGCCACATCGGGG + Intronic
1143796618 17:9342268-9342290 GTTCCTAAAAGGCCACAGACCGG + Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145009694 17:19360884-19360906 GTTCCTAACAGGCCACGGACTGG - Intronic
1146646803 17:34581512-34581534 GATCCCAACAGCCCCCAGCCCGG - Intronic
1146689365 17:34862534-34862556 GTTCCTAACAGGCAACAGACTGG - Intergenic
1146738088 17:35256860-35256882 GTTCCTAACAGGCCACAGTCAGG - Intronic
1148245920 17:46030801-46030823 GAACCTGAGCAGCCACAGCCAGG + Exonic
1149440287 17:56668053-56668075 GTTCCTAACAGGCCACAGACTGG - Intergenic
1149588256 17:57808099-57808121 GTTCCTAACAGGCCACTGACTGG - Intergenic
1149668201 17:58381278-58381300 GTTCAGAAGAGGCAACAGCCAGG + Intronic
1150181387 17:63124687-63124709 GTTCCTAATAGGCCACGGACTGG - Intronic
1150517109 17:65825426-65825448 GTTCCTAACAGGCCACAGACAGG + Intronic
1150591596 17:66567460-66567482 GATCCTGCCAGGCCACAGGCAGG + Intronic
1151331622 17:73413048-73413070 GTTCCTAACAGACCACAGACTGG - Intronic
1151413409 17:73946133-73946155 GTTCCTAACAGGCCACAGACTGG - Intergenic
1151984050 17:77530629-77530651 GTTCCTAAAGGGCCACAGACCGG + Intergenic
1152163992 17:78689602-78689624 GCTCGTAACAGGCCACAGACTGG + Intronic
1152316382 17:79583044-79583066 GTTCCTAAGGGGCCACATCAAGG + Intergenic
1152414518 17:80150607-80150629 GTTCCTAACAGGCCACAGACAGG - Intergenic
1152575678 17:81139857-81139879 TGGCCTAAGAAGCCACAGCCTGG - Intronic
1152945343 17:83194887-83194909 GTTCCTAACAGACCACAGCCTGG + Intergenic
1153205574 18:2696290-2696312 GTTCCTAAAAGGCCACAGATGGG - Intronic
1153519319 18:5937266-5937288 GTTCCTAATAGGCCACAAACTGG - Intergenic
1153533857 18:6079121-6079143 GTTCCTAACAGGCTACAGACCGG + Intronic
1154078518 18:11230271-11230293 GTTCCTAAGAGGCCATGGACAGG - Intergenic
1155401827 18:25447798-25447820 GTTCCTAACAGGCCACGGACTGG - Intergenic
1155612519 18:27682875-27682897 GTTCCTAACAAGCCACAGACTGG + Intergenic
1155690701 18:28618828-28618850 GCTCCTAACAGGCCAGAGACAGG + Intergenic
1155759638 18:29549619-29549641 GTTCCTAACAGGCCACAGACTGG - Intergenic
1155908328 18:31479022-31479044 GTTCCTAACAGGCCACAGACAGG + Intergenic
1156276179 18:35584877-35584899 GTTTCTAACAGGCCACAGACTGG + Intronic
1156542475 18:37928582-37928604 GAGCCGTGGAGGCCACAGCCTGG - Intergenic
1157209947 18:45733759-45733781 GTTCCCAACAGGCCACAGACAGG - Intronic
1157691645 18:49687291-49687313 GTTTCTAACAGGCCACAGACCGG + Intergenic
1157780243 18:50431964-50431986 GTTCCTAAGAGGCCATGGACAGG - Intergenic
1157997316 18:52573857-52573879 CATCCTAAGAGGGAACAGTCTGG - Intronic
1158285302 18:55874139-55874161 GTTCCTAACGGGCCACAGACAGG + Intergenic
1158595997 18:58816555-58816577 GTTCCTAACAGGCCACAGACCGG + Intergenic
1158862913 18:61610566-61610588 GTTTCTAACAGGCCACAGACTGG + Intergenic
1158909524 18:62046329-62046351 GTTCCTAACAGGCCACAGACTGG - Intronic
1159558360 18:69968272-69968294 GTTCCTAAAAGGCCACAGACTGG + Intergenic
1160404024 18:78632150-78632172 GATCTGAAGAGGCCACTCCCTGG - Intergenic
1160556439 18:79728599-79728621 TATTCTAAGATGCCAGAGCCTGG + Intronic
1160606793 18:80057696-80057718 GTTCCTAACAGGCCACAGATGGG - Intronic
1161732383 19:5969208-5969230 GGTCCTAAGAGTCCAGAGCCTGG - Intronic
1162037457 19:7949437-7949459 GTTCCTAACAGGCCACAGACAGG + Intergenic
1162684490 19:12370449-12370471 GCTCCTAACAGGCCACAGTCTGG + Intergenic
1162833293 19:13300078-13300100 GTTCCTAATAGGCCTCGGCCTGG + Intronic
1162855068 19:13461800-13461822 CATCCTAGGAGGCCAAAGCGGGG + Intronic
1163616835 19:18334152-18334174 GTTCCTAACAGGCCACAGACTGG - Intergenic
1164155308 19:22592255-22592277 GTTCCTAATAGGCCATAGACAGG + Intergenic
1164705550 19:30316916-30316938 GCTCCTCAGGGTCCACAGCCAGG - Intronic
1164778391 19:30872581-30872603 GATCCAGAGAGGAGACAGCCAGG + Intergenic
1165054440 19:33165203-33165225 TTTCCTAACAGGCCACAGACTGG + Intronic
1165733653 19:38162416-38162438 GAAGCTCAGAGGCCACACCCAGG - Intronic
1165779220 19:38422456-38422478 GTTCCTAACAGGCCACGGACTGG - Intronic
1165864632 19:38929234-38929256 GATCATGAGAGGGCACAGCAGGG + Intronic
1166128493 19:40731172-40731194 GTTCCTAAGAGGCCATGGACCGG - Intronic
1166582591 19:43915541-43915563 GATCCTAACAGGCCACGGACTGG - Intronic
1167802436 19:51753212-51753234 CTTCCTAACAGGCCACAGACCGG - Intronic
1167986771 19:53325027-53325049 GTTCCTAACAGGCCATAGACTGG - Intergenic
1168384640 19:55953000-55953022 GTTCCTAACAGGCCACAGACTGG - Intronic
1168568722 19:57446132-57446154 GTTCCTAACAGGCCACAGACTGG - Intronic
925029588 2:639183-639205 GTTCCTAACAGGCCACAGGCTGG + Intergenic
925103829 2:1272434-1272456 GTTCCTAACAGGCCACAGACTGG + Intronic
925180366 2:1813489-1813511 GTTCCTCACAGGCCACGGCCGGG - Intronic
925530476 2:4855338-4855360 GTTCCTAACAGGCCACGGACAGG - Intergenic
925825251 2:7841971-7841993 GTTCCTAACAGGCTACAGACTGG + Intergenic
926210960 2:10868997-10869019 GAGCCTCAGAGGCCCCAGTCAGG - Intergenic
926562206 2:14430151-14430173 GTTCCTAACAGGCCAAAGACTGG - Intergenic
927228034 2:20789670-20789692 GTTCCTGACAGGCCACAGACAGG - Intronic
927507863 2:23626353-23626375 GTTCCTAACAGGCCACAGGCTGG + Intronic
927765529 2:25803830-25803852 GTTCCTAACGGGCCACAGACTGG + Intronic
928711990 2:34017655-34017677 GTTCCTAACAGGCCACAGACTGG + Intergenic
930697750 2:54429452-54429474 GATCCAAACAGGCTTCAGCCAGG + Intergenic
930781083 2:55225175-55225197 GCTCCTAAGAGGCCACCTGCAGG + Intronic
930948390 2:57105837-57105859 GTTCCTAGCAGGCCACAGACAGG - Intergenic
931011142 2:57915758-57915780 GTTCCTAACAGGCCACAAACCGG - Intronic
931516593 2:63053878-63053900 GAGCCTGAGAGGCCACAGGTGGG - Intronic
932054344 2:68429607-68429629 GTTCCTAACAGGCCATAGACTGG - Intergenic
932927564 2:75994416-75994438 CAGCCTCAGTGGCCACAGCCTGG + Intergenic
933102815 2:78282060-78282082 CATCCTCTGAAGCCACAGCCTGG - Intergenic
933224166 2:79726357-79726379 GCTCCTAACAGGCCACGGACAGG - Intronic
933739631 2:85523358-85523380 GTTCCTAACAGGGCACAGACTGG + Intergenic
933888218 2:86740030-86740052 GTTCCTAACAGGCCACAGAGGGG - Intronic
933921960 2:87056676-87056698 GTTCCTAACAGGCCACAGAGGGG + Intergenic
934876097 2:97922296-97922318 GTTCCTAACAGGCCACAGACCGG + Intronic
935002372 2:99031651-99031673 GTTCCTAACAGACCACAGACTGG - Intronic
935103516 2:100019051-100019073 GAGCCTGAGTGGCCACAGCAAGG - Intronic
935405784 2:102707694-102707716 GATCCCAGGAGGGCTCAGCCTGG - Intronic
935725672 2:106021819-106021841 GTTCCTAACAGGCCACAGATTGG - Intergenic
935804305 2:106730989-106731011 GTTCCTAATAGGCCACAGACTGG - Intergenic
935831263 2:107002938-107002960 TATCCTCAGTGGCCACATCCTGG - Intergenic
936034506 2:109100201-109100223 GTTCCTAACAGGCCACAGACTGG - Intergenic
936042358 2:109159612-109159634 GTTCCTAACAGGGCACAGACTGG - Intronic
936755943 2:115712413-115712435 GTTCTTAACAGGCCACAGACTGG + Intronic
937043794 2:118840209-118840231 TATCCTAAGAGGCCACAATAGGG + Intergenic
938796895 2:134725052-134725074 CATCCTCAGTGGTCACAGCCTGG - Intergenic
939370398 2:141292005-141292027 GTTCCTAACAGGCCACGGACTGG - Intronic
940293786 2:152101683-152101705 GTTCCTAACAGGCCACAGACTGG - Intergenic
940986821 2:160059248-160059270 GTTCCTAACAGGCCACAAACTGG + Intronic
941002731 2:160218729-160218751 GTTGCTAACAGGCCACAGACTGG - Intronic
941075966 2:161007128-161007150 GTTCCTAACAGGCCACGGACTGG + Intergenic
941676238 2:168346098-168346120 ATTCCTAACAGGCCACAGACTGG - Intergenic
942104905 2:172624293-172624315 GTTCCTTACAGGCCACAGACTGG - Intergenic
942297685 2:174533638-174533660 GAACCAAGGAGGCCACAGTCTGG + Intergenic
942305176 2:174600150-174600172 GTTCCTAAGGGGCCATAGACTGG + Intronic
942338816 2:174921147-174921169 GTTCCTAACAGGCCACAGAGTGG + Intronic
942477623 2:176344659-176344681 GTTCCTAACAGGCCACGGACTGG - Intergenic
942944800 2:181660290-181660312 GTTCCAAACAGGCCACAGACAGG + Intronic
943058928 2:183017615-183017637 GTTCCTAACAGGCCACGGACTGG + Intronic
943294357 2:186117834-186117856 GTTCCTAATAGGCCATAGACGGG + Intergenic
943618453 2:190120069-190120091 GTTCCTAACAGGCCACGGACTGG - Intronic
943742987 2:191431275-191431297 GTTCCTAACAGGCCATAGACCGG - Intergenic
944237955 2:197457204-197457226 GTTCCTAACAGGCCACGGACAGG + Intronic
944311606 2:198239912-198239934 GTTCCTAACAGGCCACAGACTGG - Intronic
944870979 2:203911554-203911576 GTTCCTAATAGGCCTCAGACTGG + Intergenic
944896195 2:204167782-204167804 GTTCCTAACAGGCCACAGACTGG - Intergenic
945027310 2:205631416-205631438 GTTCCTAACAGGCCACAGACCGG + Intergenic
945149817 2:206778706-206778728 GTTCCTAACAGGCCACGGACTGG - Intronic
945526592 2:210895383-210895405 GTTCCTAACAGGCCACAGACTGG + Intergenic
946779309 2:223176567-223176589 GTTCCTAACAGGCCACAGACCGG - Intronic
948165358 2:235857107-235857129 GTTCCTAACAGGCCACAGACTGG - Intronic
948216505 2:236237220-236237242 GATGCTAAAAGGCCACTGGCGGG - Intronic
948250134 2:236520901-236520923 GTTCCTAACAGGCCACGGACCGG + Intergenic
948330189 2:237158423-237158445 GTTCCTAACAGGCCACAGACTGG + Intergenic
948386076 2:237581945-237581967 TGTCCTAACAGGCCACAGCAGGG - Intronic
948477480 2:238229518-238229540 ATTCCTGAGAGGCGACAGCCAGG + Intronic
948516337 2:238506066-238506088 GTTCCTAACAGGCCACAGTCGGG + Intergenic
948535741 2:238645243-238645265 GTTCCTAACAGGCCACAGACAGG - Intergenic
948621734 2:239239587-239239609 GATCCTAAGAGCTCCCTGCCAGG + Intronic
948654740 2:239469619-239469641 GTTCCTAACAGGCCACAGACTGG + Intergenic
948690257 2:239697710-239697732 GTTCCTAAAAGGCCACAGACTGG + Intergenic
1169166724 20:3430517-3430539 TTTCCTAACAGGCCACAGACTGG + Intergenic
1169171735 20:3470977-3470999 GGTCCAAAGGGGCCACAGCGGGG - Intergenic
1169322014 20:4640763-4640785 GTTCCTAACAGGCCACAGACTGG - Intergenic
1169792787 20:9429181-9429203 GATTCTTGGAGGCCACAGCAGGG - Intronic
1169946675 20:10996489-10996511 GTTCCTAACAGGCCACAGACTGG - Intergenic
1170018832 20:11813288-11813310 GTTCCTAACAGGCCTCAGACCGG + Intergenic
1170135538 20:13069645-13069667 GTTCCTAACAGGCCACAGACTGG + Intronic
1170460473 20:16573082-16573104 GGCCCCCAGAGGCCACAGCCTGG + Intronic
1171274766 20:23847284-23847306 GCTCAGCAGAGGCCACAGCCAGG - Intergenic
1171282357 20:23911380-23911402 GCTCAGCAGAGGCCACAGCCAGG - Intergenic
1172107326 20:32524619-32524641 GATCCAAAAAGTCCTCAGCCAGG + Intronic
1172239086 20:33400208-33400230 GTTCCTCACAGGCCACAGACAGG + Intronic
1172622004 20:36323931-36323953 GTTCCTAACAGGCCACAGACTGG + Intronic
1172678514 20:36693521-36693543 GTTCCTAAGAGGGCACAGACTGG - Intronic
1173320809 20:41985316-41985338 CTTCCTAACAGGCCACAGACTGG - Intergenic
1173546475 20:43902023-43902045 GTTCCTAACAGGCTACAGACCGG - Intergenic
1173570585 20:44073174-44073196 GTTCCTGACAGGCCACAGACTGG - Intergenic
1173833510 20:46109161-46109183 GCTCCTAACAGGCCACGGACTGG - Intergenic
1174427863 20:50445893-50445915 GTTCCTAATAGGCCACGGACTGG - Intergenic
1174565104 20:51458836-51458858 GATTACAAGAGGCCACAGCCAGG + Intronic
1174866600 20:54142284-54142306 GTTCCTTACAGGCCACAGACTGG + Intergenic
1174986666 20:55461621-55461643 GTTCCTAACAGGCCACAAACTGG - Intergenic
1175203610 20:57294248-57294270 ATTCCTAACAGGCCACAGACCGG + Intergenic
1175531789 20:59678456-59678478 GGTCCTAAGAGGCCCTAGACAGG - Intronic
1175805866 20:61829104-61829126 GTTCCTAACAGGCCACAGACCGG + Intronic
1175966822 20:62664113-62664135 TATCCTGAGACCCCACAGCCAGG + Intronic
1176049637 20:63111102-63111124 GAGCCTAGAAGGCCACCGCCTGG - Intergenic
1177146250 21:17410321-17410343 GGTCCTAATAGGCCGCAGACCGG - Intergenic
1177417161 21:20808760-20808782 GTTCCTAACAGGCCACAGACCGG - Intergenic
1177832215 21:26151810-26151832 GCTCCTAACACGCCACAGACCGG + Intronic
1178297343 21:31421385-31421407 GCTCCTAACAGGCCATAGACTGG - Intronic
1178319723 21:31596157-31596179 GTTCCTAACAGGCCACAGAACGG - Intergenic
1178458336 21:32776855-32776877 GTTCCTAACAGGCCACTGACTGG - Intergenic
1178604919 21:34027799-34027821 GTTCCTAAGAGGCCATGGACTGG - Intergenic
1178844752 21:36165538-36165560 GTTCCTAATAGGCCACGGACTGG - Intronic
1178980308 21:37258032-37258054 GAGACTAAGCGGCCACAGCAGGG + Intronic
1179057086 21:37946181-37946203 GTTCCTAACAGGCCACAGAGCGG - Intergenic
1179427024 21:41289670-41289692 GTTCCTAATAGACCACAGACCGG + Intergenic
1180100778 21:45584005-45584027 GTTCCTAACAGGCCACAGACTGG + Intergenic
1180614571 22:17119393-17119415 AATTCTGAGAGGCCACAGCCAGG + Exonic
1181054793 22:20255743-20255765 GCTCCTGAGGGGCCCCAGCCTGG - Intronic
1181567343 22:23747210-23747232 GTTCCTAACAGGCCACAGACTGG - Intronic
1181624109 22:24111315-24111337 GTTCCTAACAGGCCACGGACTGG - Intronic
1181644624 22:24224680-24224702 GAGTCTGAGAGGCCCCAGCCAGG + Intronic
1182357162 22:29727419-29727441 GATCCCAAGAGGTCACTGCTGGG + Intronic
1182722574 22:32415267-32415289 GTTCCTAACAGGCCACAGACCGG + Intronic
1182879382 22:33720412-33720434 GTTCCTAATAGGCCACGGACTGG + Intronic
1183756586 22:39772335-39772357 GTTCCTAACAGGTCACAGACTGG + Intronic
1184101897 22:42345146-42345168 GCACCTGTGAGGCCACAGCCAGG + Intergenic
1184433888 22:44458469-44458491 GTTGCTAAGAGACCAGAGCCTGG - Intergenic
1184883472 22:47327255-47327277 GCTCCTAACAGGCCACGGACTGG + Intergenic
1184976480 22:48065990-48066012 GCACCTGAGAGCCCACAGCCAGG - Intergenic
1185251254 22:49802749-49802771 GCTCTTAAGAGGCCAGAGTCAGG - Intronic
1185304282 22:50104274-50104296 GTTTCTAACAGGCCACAGTCCGG + Intronic
949293665 3:2495524-2495546 GTTCCTAACAGGCCACAGACAGG - Intronic
950261218 3:11544423-11544445 GACTCTAAGAGGCCCCAGGCAGG - Intronic
950374815 3:12562575-12562597 GTTCCTAAAAGGCCATAGACTGG - Intronic
950992857 3:17459461-17459483 GTTCCTAACAGGCCACAGCCTGG + Intronic
951050640 3:18089414-18089436 GTTCCTAACAGGCCACGGACTGG - Intronic
951628149 3:24689472-24689494 GTTCCTAACAGGCCACAGACTGG - Intergenic
951896865 3:27617804-27617826 GACGCCAAGAGCCCACAGCCAGG - Intergenic
952709992 3:36420426-36420448 GTTCCTAACAGGCTACAGACCGG - Intronic
953227451 3:41033672-41033694 GTTCCTAACAGGCCACAGATTGG + Intergenic
953391818 3:42538336-42538358 TATCCTCAGAGGCCAGAGTCAGG + Intergenic
953879934 3:46686337-46686359 GAGCCTGTGTGGCCACAGCCTGG + Exonic
954476351 3:50749980-50750002 GTTCCTAACAGGCCACAGATTGG - Intronic
954942321 3:54385420-54385442 GAACATCAGAGGCCAGAGCCAGG - Intronic
955022235 3:55132600-55132622 GTTCCTAACAGGCCACGGACTGG - Intergenic
955617581 3:60825504-60825526 GTCCCTAACAGGCCACAGACTGG - Intronic
955623901 3:60895960-60895982 GTTCCTAACAGGCCACAGACTGG - Intronic
956213831 3:66827921-66827943 GTTCCTAACAGGCCACAGACCGG + Intergenic
956308563 3:67853706-67853728 GATCCTAAGTCACCAAAGCCTGG - Intergenic
956390590 3:68769059-68769081 GTTCCTAACAGGCCACAAACTGG - Intronic
956393496 3:68799785-68799807 GTTCCTAACAAGCCACAGACAGG - Intronic
956877514 3:73478193-73478215 GTTACTAACAGGCCACAGACTGG - Intronic
957623349 3:82624173-82624195 GTTCATAACAGGCCACAGACTGG - Intergenic
957801554 3:85090645-85090667 GTTCCTAACAGGCCACTGACCGG - Intronic
958437829 3:94119565-94119587 GTTCCTAATAGGTCACAGACTGG + Intronic
958465656 3:94454275-94454297 GTTCCTGAGAGGCCATAGACTGG + Intergenic
958920228 3:100097007-100097029 GTTCCTAACAGGCCACAGAGTGG - Intronic
959033663 3:101334133-101334155 GCTCCTAACAGGCCACAGACTGG + Intronic
959040846 3:101422004-101422026 GTTCCTAACAGACCACAGACTGG - Intronic
959294245 3:104514939-104514961 GTTCCTAATAGGCCACAGACAGG - Intergenic
959775910 3:110162784-110162806 GTTCCTAACAGGCCACAAACGGG - Intergenic
960164263 3:114384060-114384082 GAGACTGAGAGGCCAGAGCCTGG - Intronic
960537556 3:118830158-118830180 GTTTCTAACAGGCCACAGACTGG - Intergenic
960766448 3:121135745-121135767 GTTCCTAACAGGCCACAGACTGG + Intronic
960823423 3:121758147-121758169 GTTCCTAACAGGCCACGGACTGG + Intergenic
961727287 3:128939935-128939957 GTTCCTAACAGGCCAGAGACCGG + Intronic
962053215 3:131841398-131841420 GTTCCTAACAGGCCACAGACTGG - Intronic
962197620 3:133377735-133377757 GTTCCTAACAGGCCACAGACTGG - Intronic
962332203 3:134488050-134488072 GTTCCTAACAGGCCACGGACTGG - Intronic
962857627 3:139363239-139363261 ATTCCTAACAGGCCACAGACTGG - Intronic
963147343 3:142007948-142007970 GCTCCTAACAGGCCACGGACTGG + Intronic
963536789 3:146539410-146539432 GTTCCTAACAGGCCACAGACTGG + Intronic
964876825 3:161376885-161376907 GTTCCTAACAGGCCACAGATAGG - Intergenic
965639274 3:170815520-170815542 GTTCCTAACAGGCCACAGACTGG - Intronic
965769582 3:172167657-172167679 GTTCCTAACATGCCACAGACAGG - Intronic
966358481 3:179107865-179107887 GTTCTTAACAGGCCACAGACTGG + Intergenic
967009868 3:185422803-185422825 GTTCCTAACAGGCCACAGACTGG - Intronic
967455147 3:189676739-189676761 GTTCCTAACAGGCCACAGATGGG - Intronic
968167053 3:196475097-196475119 GAGCCTAAGAGGACTCAGACAGG + Intronic
968331485 3:197874173-197874195 GTTCCTAACAGGCCACAGACTGG - Intronic
969192229 4:5531425-5531447 GTTCCTAACAGGCCATAGGCCGG - Intergenic
969674033 4:8605121-8605143 GTTCCTCAGATGCCACATCCCGG - Intronic
970170021 4:13280171-13280193 GTTCCTAACAGGCCACAGACTGG - Intergenic
970388896 4:15587315-15587337 GTTCCTAACAGGCCACAGACTGG + Intronic
970620829 4:17816369-17816391 GTTCCTAACAGGCCACAGACTGG + Intronic
970633483 4:17980719-17980741 TTTCCTAACAGGCCACAGACTGG - Intronic
970924422 4:21434517-21434539 GTTCCTAACAGGCCACAGAGTGG - Intronic
971032932 4:22660546-22660568 GTTCCTAACAGGCCACGGACTGG - Intergenic
971212936 4:24637242-24637264 GCTCCTAACAGGCCACAGCCAGG - Intergenic
971564556 4:28120754-28120776 GCTCCTAACAGGCCACAGACTGG + Intergenic
971755244 4:30699342-30699364 GTTCCTAACAGGCCACAAACTGG + Intergenic
972027654 4:34405536-34405558 GATCCTAGCAGGCCACAGGCTGG + Intergenic
972187300 4:36545492-36545514 ATTCCTAATAGGCCACAGACTGG + Intergenic
972622569 4:40762668-40762690 GTTCCTAACAGGCCACAGACAGG - Intronic
972663389 4:41140605-41140627 GTTCCTAACAGGCCACAGACTGG - Intronic
973977866 4:56281114-56281136 GTTCCTAACAGGCCACACACCGG - Intronic
973990706 4:56404005-56404027 GTTCCTAACAAGCCACAGACTGG + Intronic
974347832 4:60704357-60704379 GTTCCTAACAGGCCACAGAGTGG - Intergenic
976231918 4:82853076-82853098 GTTCCTAAGAGGCCACAGAAGGG + Intronic
976482864 4:85564846-85564868 GTTCCTAACTGGCCACAGACTGG + Intronic
976668155 4:87622484-87622506 GTTCCTAACAAGCCACAGACCGG + Intergenic
976674569 4:87690322-87690344 GTTTCTAATAGGCCACAGACTGG - Intergenic
977388933 4:96382958-96382980 GTTCCTATTAGGCCACAGACTGG + Intergenic
977420606 4:96795202-96795224 GTTTCTAACAGGCCACAGACTGG + Intergenic
977810554 4:101350435-101350457 GTTCCTAATAGGCCACAGACTGG + Intergenic
978623192 4:110655111-110655133 GTTCCTAACAGGCCACAGACTGG + Intergenic
978989026 4:115054927-115054949 GTTGCTAACAGGCCACAGACTGG - Intronic
979464092 4:121016612-121016634 GTTCCTAACAGGCCACGGACCGG + Intergenic
979489510 4:121309019-121309041 GTTCCTAACAGGCCACAGACAGG - Intergenic
979852526 4:125591561-125591583 GTTCCTAACAGGTCACAGACTGG + Intergenic
979977766 4:127218257-127218279 GTTCCTAACAGGCCACGGACTGG - Intergenic
981000109 4:139821249-139821271 GTTCCTAACAGGCCACGGACTGG - Intronic
981591311 4:146365853-146365875 GTTCCTAACAGGCCACAGACTGG - Intronic
981734712 4:147936849-147936871 GTTCCTAATAGGCCACGGTCTGG - Intronic
982023896 4:151232953-151232975 GTTCCTAACAGGCCATAGACTGG - Intronic
982049469 4:151486197-151486219 GTTCCTAACAGGCCAGAGACTGG + Intronic
982146833 4:152403792-152403814 GTTCCTAACAGGCCACAGACTGG + Intronic
983295058 4:165856783-165856805 GTTCCTAACAGGTCACAGACAGG + Intergenic
983850249 4:172571089-172571111 GTTCCTAAAAGGCCACAGACTGG + Intronic
984385295 4:179048035-179048057 GTTCCTAACAGGCCACAGACTGG + Intergenic
984772943 4:183454120-183454142 GTTCCTAACAGGCCACAGACTGG + Intergenic
985002545 4:185500309-185500331 GTTGCTAAAAGGCCACAGACTGG + Intergenic
985488753 5:166657-166679 GTTCCTAATAGGCCACAGATGGG + Intronic
985684499 5:1274712-1274734 GTTCCTAACAGGCCCCAGACCGG + Intronic
987018829 5:13848875-13848897 GTTCCTAACAGGCCACAGACTGG + Intronic
987184939 5:15407696-15407718 GTTCCTAACAGGCCACAGACCGG + Intergenic
987230628 5:15890137-15890159 GTTCCTAACTGGCCACAGACCGG - Intronic
988813622 5:34808994-34809016 GATCCTAACAGGCCACAGACTGG + Intronic
989163605 5:38414039-38414061 CTTCCTAACAGGCCACAGACTGG + Intronic
989227543 5:39047460-39047482 GTTCCTAACAGGCCACGGACTGG + Intronic
989747500 5:44847441-44847463 GTTCCTAACAGGCCACTGACAGG + Intergenic
990009643 5:50981591-50981613 GTTCCTAACAGGCCATAGCCAGG - Intergenic
990397219 5:55394660-55394682 GTTCTTAACAGGCCACAGACTGG + Intronic
990972175 5:61520064-61520086 GTTCCTAACAGACCACAGACTGG + Intronic
991036848 5:62135925-62135947 GTTCCTAACAGGCCATAGACCGG + Intergenic
991622476 5:68559205-68559227 GTTCGTAACAGGCCACAGACTGG - Intergenic
992497363 5:77307094-77307116 GATCCTCAGAGGACACAGGAAGG - Intronic
992613520 5:78528268-78528290 GTTCCTAACAGGCCACAGACCGG - Intronic
992652736 5:78876765-78876787 GTTCCTAATAGGCCACAGATGGG - Intronic
993011870 5:82492298-82492320 CTTCCTAACAGGCCACAGACTGG - Intergenic
993391343 5:87322197-87322219 GCTCCTAACAGGCCATAGACAGG - Intronic
993426047 5:87765245-87765267 GTTCCTAACAGGCCGCAGACTGG + Intergenic
993855208 5:93065956-93065978 GTTCCTAACAGGCCACAGAGTGG - Intergenic
994516762 5:100782175-100782197 GTTCCTAACAGGCCACTGACTGG - Intergenic
994690966 5:103019047-103019069 GTTCCTAACAGGCCATGGCCCGG + Intronic
994978682 5:106844109-106844131 GATCCTCAGAGGCCAAAACATGG + Intergenic
995627816 5:114098367-114098389 GTTCCTAACAGGCCACAGACTGG - Intergenic
996228366 5:121030403-121030425 GTTCCTAACAGGCCACAGACTGG + Intergenic
996713726 5:126569026-126569048 GCTCCTAATAGGCCACAGACTGG - Intronic
997693850 5:135845994-135846016 GTTCCTAACAGGCCACAGGCTGG - Intronic
997740897 5:136252846-136252868 ATTCCTAACAGGCCACAGACTGG + Intronic
997809987 5:136957614-136957636 AATCCTATGATGCCACACCCTGG - Intergenic
997811520 5:136975025-136975047 GTTCCTAAGAGGCCACAGACTGG + Intergenic
997924330 5:138014320-138014342 GTTCCTAACAGGCCACAGACTGG - Intronic
998926707 5:147134701-147134723 GTTCCTAACAGACCACAGACTGG + Intergenic
999502873 5:152164393-152164415 GTTCCTAACAGACCACAACCTGG - Intergenic
999512661 5:152268936-152268958 GTTCCTAACAGGCCATAGACTGG + Intergenic
999559297 5:152782844-152782866 GTTCCTAACAGGGCACAGACTGG + Intergenic
999587234 5:153103423-153103445 GTTCCTAACAGGCCACAAACTGG - Intergenic
999762076 5:154710164-154710186 GTTTCTAACAGGCCACAGACTGG + Intergenic
1000308740 5:160020495-160020517 GTTCCTTACAGGCCACAGACTGG - Intronic
1000769056 5:165328517-165328539 CATAATAAGGGGCCACAGCCTGG + Intergenic
1000833077 5:166127673-166127695 GAACCTGAGAGCCAACAGCCTGG + Intergenic
1001559309 5:172658969-172658991 GCTCCTCAGAGGCCACAGTTTGG - Intronic
1001674017 5:173497711-173497733 TGTCCTAAGAGGACACAGCAGGG - Intergenic
1002195566 5:177499028-177499050 GTTCCTAACAGGCCACAAACGGG - Intergenic
1002323682 5:178390994-178391016 GTTCCTAACAGGCCACAAACTGG - Intronic
1003141761 6:3477721-3477743 GTTCCTAACAGACCACAGACTGG + Intergenic
1003696680 6:8412903-8412925 GTTCCTAACAGGCCACGGACTGG + Intergenic
1003882339 6:10490086-10490108 GTTCCTAACAAGCCACAGACTGG - Intergenic
1004779771 6:18895528-18895550 GATTCTAATGGGCCACAGACTGG - Intergenic
1004795629 6:19080167-19080189 GTTCCTAACAGGCCACAGACCGG - Intergenic
1004852271 6:19712385-19712407 GTTCCTAACAGGTCACAGACTGG - Intergenic
1004982309 6:21039075-21039097 GATCCTAACAGGCCATGGACTGG - Intronic
1005086784 6:22015161-22015183 GTTCCTAACAGGCCACAGACTGG - Intergenic
1005255590 6:23999459-23999481 ACTCCTGAGTGGCCACAGCCAGG - Intergenic
1005387973 6:25304651-25304673 GTTCCTAACAGGCCACAGACTGG + Intronic
1005660526 6:27994259-27994281 GTTCCTAACAGGCCACGGACTGG - Intergenic
1006423801 6:33951294-33951316 CATCCTAAGAGGCCAGTGACTGG - Intergenic
1006720169 6:36145076-36145098 GTTCCTAACAGGCCACAGACAGG + Intergenic
1006871351 6:37255087-37255109 GTTCCTAACAGGCAACAGACAGG + Intronic
1006977566 6:38117636-38117658 GATTCTCAGAGGCTACAGACAGG - Intronic
1007152647 6:39709515-39709537 GTTCCTAACAGGCCACAGACTGG + Intronic
1008130235 6:47712939-47712961 GATCCTAAGAGGCCACAGCCCGG - Intronic
1008523813 6:52387727-52387749 GTTCCTAACAGGCCACAGACAGG - Intronic
1008596188 6:53044161-53044183 GCTCCTAACAGGCCACAGACTGG - Intronic
1008950834 6:57156993-57157015 GTTCTTAACAGGCCACAGACTGG + Intronic
1008955662 6:57213266-57213288 GTTCCTAACAGGCCACAGAACGG + Intronic
1009513418 6:64582207-64582229 GTTCCTAACAGGCCACAGACAGG - Intronic
1009922747 6:70083022-70083044 GTTCCTAACAGTCCACAGACCGG + Intronic
1009962087 6:70535383-70535405 GTTCCTAAGAGGCCACAGACAGG - Intronic
1010776632 6:79894055-79894077 GTTCCTAACAGGCCACAAACCGG - Intergenic
1011027624 6:82886467-82886489 GTTCCTAATAGGACACAGGCTGG + Intergenic
1011637646 6:89389078-89389100 GTTCCTAACAGGCCACAGACTGG + Intronic
1012211995 6:96530927-96530949 GTTCCTAACAGGCCACAGACTGG - Intronic
1012973391 6:105754914-105754936 GTTCCTAACAGGCCACAGAATGG - Intergenic
1013377280 6:109529917-109529939 GTTCCTCATAGGCCACAGACTGG + Intronic
1013465855 6:110416457-110416479 GTTCCTAACAGGCCACGGACTGG + Intergenic
1014151522 6:118061947-118061969 GTTCCTAACAGGCCACGGACTGG + Intronic
1014304970 6:119728383-119728405 GTTCCTAACAGGACACAGACTGG + Intergenic
1014460446 6:121688322-121688344 GTTCCTAACAGGCCACAGACAGG + Intergenic
1014474650 6:121857655-121857677 GTTCCTAACAGGCCACTGACTGG - Intergenic
1014720507 6:124911926-124911948 GCTCCTAATAGGCCACAGACTGG + Intergenic
1014895900 6:126898658-126898680 GTTCCTAACAGGCCACAGACTGG + Intergenic
1015066805 6:129039889-129039911 GTTCCTAACAGGCCACAGGCTGG + Intronic
1015201226 6:130583524-130583546 GTTCCTAACAGGCCACGGACTGG + Intergenic
1015305044 6:131697798-131697820 GTTCCTAACAGGCCACAGACAGG + Intronic
1015553851 6:134440677-134440699 GTTTCTAACAGGCCACAGACTGG - Intergenic
1015942760 6:138468396-138468418 GTTCCTAACAGGCCACAGATGGG - Intronic
1015953730 6:138579194-138579216 GTTCCTAATAGGCCACAGCCTGG + Intronic
1015985663 6:138881875-138881897 GTTCCTAACAGGCCACAGACTGG + Intronic
1016025883 6:139286582-139286604 GTTCCTAACAGGCCACGGACTGG - Intronic
1016666908 6:146652928-146652950 GTTCCTAACAGGCCACAGATTGG - Intronic
1016757012 6:147698185-147698207 GTTCCTAACAGGCCACAGACCGG + Intronic
1016844985 6:148560945-148560967 GATCCTAACAGGCCATGGACTGG - Intergenic
1016984098 6:149881448-149881470 CAGCCTAAGAGGCCACTGCCAGG - Intergenic
1017055785 6:150434497-150434519 GTTCCTAAGAGGCCACGGACTGG - Intergenic
1017061015 6:150485080-150485102 GTTCCTAACAAGCCACAGACCGG + Intergenic
1017735597 6:157360088-157360110 GTTCCTAACAGGCCATAGACAGG + Intergenic
1018097021 6:160397366-160397388 GTTCCTAACAGGCCACAAACTGG + Intronic
1018220876 6:161578164-161578186 GAATCAAAGAGGCCAAAGCCTGG + Intronic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1018489301 6:164275414-164275436 GTTCCTAACAGGCCACAGACTGG - Intergenic
1018751957 6:166814462-166814484 GTTCCTAACAGGCCACGGGCTGG - Intronic
1021177285 7:17463608-17463630 GCTCCTAACAGGCCACGGACAGG - Intergenic
1021554361 7:21904445-21904467 GTTCCAAACAGGCCACAGACTGG - Intronic
1021738506 7:23662266-23662288 GTTTCTAATAGGCCACAGACCGG - Intergenic
1021749979 7:23787448-23787470 GTTCTTAACAGGCCACAGACTGG - Intronic
1023327030 7:39071420-39071442 GTTCCTAACAGGCCACAGACTGG + Intronic
1023383922 7:39635849-39635871 GTTCCTAACAGGCCACAGACTGG + Intronic
1023549098 7:41349914-41349936 GTTCCTAACAGGCCACGGACCGG - Intergenic
1023591005 7:41780509-41780531 GTTCCTAACAGGCCACAGACTGG - Intergenic
1024053824 7:45646817-45646839 GACCCTAAGTGGCCAGACCCTGG + Intronic
1024410408 7:49034235-49034257 GTTTCTAACAGGCCACAGACTGG + Intergenic
1024690424 7:51795490-51795512 GTTCCTAACAGGCCACAGACAGG + Intergenic
1024790626 7:52961380-52961402 AATACTAAGAGGAAACAGCCAGG - Intergenic
1025104732 7:56161804-56161826 GTTCCTAACAGGTCACAGACTGG - Intergenic
1025178039 7:56811729-56811751 GGCCCGAAGAGGCCACGGCCAGG + Intergenic
1025218775 7:57086136-57086158 GTTCCTAACAGGCCACGGACTGG - Intergenic
1025625607 7:63218617-63218639 GTTCCTAACAGGCCATAGCCTGG + Intergenic
1025629700 7:63259724-63259746 GTTCCTAACAGGCCACGGACTGG - Intergenic
1025652574 7:63484303-63484325 GTTCCTAACAGGCCACGGACTGG + Intergenic
1025656509 7:63524554-63524576 GTTCCTAATAGGCCATAGCCTGG - Intergenic
1026300543 7:69094055-69094077 GTTCCTGACAGGCCACAGACTGG + Intergenic
1026310101 7:69175852-69175874 GTTGCTAACAGGCCACAGACCGG - Intergenic
1026313781 7:69210866-69210888 GTTCCTAACAGGCCACAGACTGG - Intergenic
1026316032 7:69228457-69228479 GTTCCTAACAGGTCACAGACTGG + Intergenic
1026550729 7:71366215-71366237 GATTCTAACAGGTCACAGACTGG + Intronic
1026620446 7:71945480-71945502 GTTCCTAACAGGCCACAGACTGG - Intronic
1026650834 7:72214666-72214688 GCTCCTAATAGGTCACTGCCTGG - Intronic
1026682333 7:72476536-72476558 GGTCCTAAGAGGTCTCAGTCAGG - Intergenic
1027181274 7:75941195-75941217 GAACCTGAGATCCCACAGCCTGG + Intronic
1027195882 7:76029943-76029965 GTTCCTAACAGACCACAGACTGG + Intronic
1027225762 7:76242929-76242951 GTTCCTAATAGGCCACAGAGTGG + Intronic
1027398784 7:77786397-77786419 GTTCCTAATAGGCCACGGGCTGG + Intergenic
1028181877 7:87733844-87733866 GTTCCTAACAGGCCACGGACAGG + Intronic
1028297109 7:89147587-89147609 GTTCCTAACAGGCAACAGACTGG - Intronic
1029034396 7:97503588-97503610 GTTCTTAACAGGCCACAGACCGG - Intergenic
1029431793 7:100535999-100536021 GTTCCTAACAGGCCACAGACAGG + Intergenic
1029491039 7:100870279-100870301 GTTCCTAACAGGCCATGGCCTGG + Intronic
1030900612 7:115118966-115118988 GTTCCTAAGAGGTCACAGATGGG - Intergenic
1030948838 7:115763560-115763582 GTTCCTAAGAGGCCATGGACAGG + Intergenic
1031045200 7:116879705-116879727 GTTCCTAACAGGCCCCAGACTGG + Intronic
1031683923 7:124709220-124709242 CACCCTCAGTGGCCACAGCCTGG + Intergenic
1031826747 7:126575105-126575127 GTTCCTAACAGGCCACAAACCGG - Intronic
1032192418 7:129772542-129772564 TATCCTAAGTGCCCCCAGCCTGG + Intergenic
1032446093 7:131984874-131984896 GTTCCTAACAGGCCACAGAGTGG - Intergenic
1033163260 7:139015950-139015972 CATCCTAAGAGTCCACTGCATGG - Intergenic
1033292520 7:140099542-140099564 GTTCCTAACAGGCCACGGACTGG - Intronic
1033479826 7:141728705-141728727 GTTCCTAACAGGCCACAGACTGG - Intronic
1033608583 7:142944775-142944797 GATCAGGAGAGGCCTCAGCCTGG + Intronic
1034007991 7:147495809-147495831 GTTCCTAAAAGGCCACAAACTGG - Intronic
1034046178 7:147930048-147930070 GTTCCTAACAGGCCACAGACTGG + Intronic
1034144162 7:148853559-148853581 GTTCCTAACGGGCCACAGACGGG + Intronic
1035015061 7:155758582-155758604 GTTCCTAACAGGCCACAGACTGG + Intronic
1035286092 7:157808137-157808159 GTTCCTAACAGGCCACAGACTGG - Intronic
1035876083 8:3191157-3191179 AATCCTAACAAGCCCCAGCCGGG + Intronic
1036005089 8:4653013-4653035 GTTCCTAACAGGCCACAGATAGG + Intronic
1036132751 8:6131697-6131719 GTTCCTAACAGGCCACAAACAGG + Intergenic
1036159700 8:6375693-6375715 GTTCCTAACAGGCCACAAACTGG - Intergenic
1036172017 8:6496420-6496442 GTTCCTAATAGGCCACAGACTGG + Intronic
1036431689 8:8697999-8698021 GTTCCTGACAGGCCACAGACTGG - Intergenic
1036586300 8:10126979-10127001 GTTCCCAACAGGCCACAGCCTGG + Intronic
1037530334 8:19766614-19766636 GTTCCTAACAGGCCAGAGACTGG - Intergenic
1037603613 8:20419538-20419560 GTTCCTAACAGGCCACTGACTGG + Intergenic
1037690392 8:21176907-21176929 GTTCCTAACAGGCCACAGACTGG + Intergenic
1038191088 8:25321731-25321753 GTTCCTAACAGGCCACAGACTGG + Intronic
1038351569 8:26780655-26780677 GTTTCTAACAGGCCACAGACTGG - Intronic
1038676008 8:29623555-29623577 GTTCCTAACAGGCCACGGACTGG + Intergenic
1038706586 8:29899570-29899592 GTTCCTAACAGGCCACAGACTGG - Intergenic
1039042333 8:33419561-33419583 GTTCCTAACAGGCCACGGACAGG + Intronic
1039114241 8:34074493-34074515 GTTCCTAACAGGCCACAGATGGG + Intergenic
1039604059 8:38866468-38866490 GTTCCTAAGAGGCCAGTCCCTGG + Intergenic
1039961094 8:42248306-42248328 ATTCCTAACAGGCCACAGACCGG + Intergenic
1040031094 8:42824428-42824450 GTTCCTAACAGGCCACAGACTGG + Intergenic
1040858975 8:51979393-51979415 GTTCCTAACAGGCCACAGAGCGG + Intergenic
1041498547 8:58514337-58514359 GTTCCTAAAAGGCCACAGACGGG - Intergenic
1041928266 8:63260278-63260300 GTTCCTAACAGGCCACAGACTGG - Intergenic
1042803335 8:72744857-72744879 GATCCTGAGGGCCCACAGCCAGG + Intronic
1043417920 8:80070639-80070661 GTTCCTAACAGGCCACAGATGGG + Intronic
1043544698 8:81302180-81302202 GTTCCTAACAGGCCACTGCCGGG - Intergenic
1044136711 8:88594761-88594783 GTTCCTAACAGGCCACAGACTGG + Intergenic
1044586791 8:93875895-93875917 GTTCATAACAGGCCACAGGCTGG + Intronic
1044900560 8:96939361-96939383 ATTCCTAACAGGCCACAGACTGG + Intronic
1045283746 8:100772342-100772364 GTTCCTAACAGGCCACAGAAGGG + Intergenic
1045294410 8:100861027-100861049 GTTCCTAACAGGCCACTGACTGG + Intergenic
1045885949 8:107097978-107098000 GTTCCTAACAGGCCACAGAATGG + Intergenic
1046070385 8:109245859-109245881 GTTCCTAAAAGGCCACTGACTGG - Intronic
1046524523 8:115367553-115367575 GTTCCTAACACGCCACAGACTGG - Intergenic
1046534950 8:115497417-115497439 GTTCCTAACAGGCCACAGACTGG + Intronic
1046622497 8:116543157-116543179 GTTCCTAACAGGCCACGGACCGG + Intergenic
1047188551 8:122657412-122657434 GTTCCTAACAGGCCATAGACTGG + Intergenic
1047478632 8:125259294-125259316 GTTCCTAACAGGCCACCGACTGG - Intronic
1048044823 8:130763734-130763756 GTTCCTAACAGGCCACAGACAGG + Intergenic
1048583415 8:135749934-135749956 GTTCTTAACAGGCCACAGACAGG - Intergenic
1048599079 8:135899782-135899804 GTTCCTCACAGGCCACAGGCAGG - Intergenic
1048723760 8:137358434-137358456 GTTCCTAACAGGCCACAGATTGG - Intergenic
1049219159 8:141421008-141421030 GTTCCTAAGAAGCCTGAGCCTGG - Intronic
1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG + Intronic
1049626056 8:143621990-143622012 GTTCCTAACAGGCCACAGACCGG + Intergenic
1049642301 8:143721193-143721215 GGTGCTCAGAGGTCACAGCCTGG - Intronic
1051000945 9:12280961-12280983 GTTCCTAACAGCCCACAGACTGG + Intergenic
1051286413 9:15501931-15501953 GTTCCTAACAGGCCACGGACGGG - Intronic
1051554335 9:18365757-18365779 GTTCCTAACAGGCCACAGATAGG - Intergenic
1051689571 9:19695989-19696011 GTTCTTAACAGGCCACAGACTGG - Intronic
1052038072 9:23705805-23705827 GTTCCTAACAGGCCACGGACTGG + Intronic
1052293128 9:26866933-26866955 GTTCCTAACAGGCCACAGATTGG - Intronic
1052390417 9:27872564-27872586 GTTCCTAACAGGCCACAAACTGG + Intergenic
1053136860 9:35656503-35656525 GAGCCTAACAGGCCACAGGCTGG - Intergenic
1053153166 9:35755758-35755780 CTTCCTAACAGGCCACAGACTGG + Exonic
1054809768 9:69425539-69425561 GTTCCTAACAGGCCACAGACTGG - Intergenic
1055539747 9:77291063-77291085 GTTCCTAACAGGTCACAGACCGG - Intronic
1055883965 9:81036993-81037015 GCTCCTAAGATGTCACAGGCTGG - Intergenic
1055909324 9:81329314-81329336 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056144088 9:83712017-83712039 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056189175 9:84167828-84167850 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056885055 9:90433752-90433774 GTTCCTAACAGGCCACAGACAGG - Intergenic
1057007164 9:91570380-91570402 GTTCCTAACAGGCCACAGACTGG + Intronic
1057062771 9:92020278-92020300 GATCCTAACAGGCCAGGGACTGG - Intergenic
1057141160 9:92727570-92727592 GACCCTCAAAGGCCACGGCCAGG + Intronic
1057244747 9:93445384-93445406 GGTACTAAGAGTCCCCAGCCTGG - Intergenic
1057460175 9:95254026-95254048 GTTCCTAACAGGCCACGGACTGG + Intronic
1058824945 9:108766892-108766914 GTTCCTAACAGGCCACTGACTGG - Intergenic
1059151734 9:111955290-111955312 GCTCCTAACAGGCCACAGACGGG + Intergenic
1059164346 9:112064205-112064227 GTTCCTAACAGGCCACAGACTGG - Intronic
1059347999 9:113645343-113645365 GCTCCTAACAGGCCACAGACTGG - Intergenic
1059795734 9:117694451-117694473 GTTCCTAACAGGCCACAGACTGG - Intergenic
1060309738 9:122448543-122448565 CATCCCAAGAGGCCATATCCAGG + Intergenic
1061527830 9:131182296-131182318 GTTCCTAAGAGGCCACAGACCGG - Intronic
1062005348 9:134235988-134236010 CATCCCAGGAGCCCACAGCCAGG - Intergenic
1062418678 9:136467820-136467842 GAGCACTAGAGGCCACAGCCAGG + Intronic
1062430159 9:136523362-136523384 GCTCCCAAGAGGCCTGAGCCTGG + Intronic
1185742375 X:2544139-2544161 GTTCCTAACAGGCCACAGACTGG - Intergenic
1185981513 X:4785120-4785142 GTTCCTAACAGGCCACAGACCGG - Intergenic
1186008320 X:5100132-5100154 AATCCTAACAGGTCACAGACTGG - Intergenic
1186456959 X:9717343-9717365 GAACCGAAGAAGCCACAGGCAGG + Exonic
1186553484 X:10532192-10532214 TATCAAAAGAGGCCACAGGCAGG + Intronic
1186565159 X:10654654-10654676 GTTCCTAACAAGCCACAGACTGG + Intronic
1187460673 X:19484144-19484166 GTTCCTAACAGGCCACTGACCGG - Intronic
1188065935 X:25659290-25659312 GTTCCTAACAGGCCACAGACTGG + Intergenic
1188232865 X:27687042-27687064 GTTCCTAACAGGCCACAGACAGG + Intronic
1188469216 X:30518351-30518373 GTTCTTAAGAGGCCACAGCCTGG + Intergenic
1189048633 X:37620156-37620178 AATCCTCAGGGGACACAGCCTGG + Intronic
1189483881 X:41414260-41414282 GCTCCTAACAGGCCACAGACTGG - Intergenic
1189749852 X:44209683-44209705 GTTCCTAACAGGCCACGGACTGG - Intronic
1189880212 X:45483181-45483203 GTTCCTAACAGGCCACAAACTGG + Intergenic
1190027191 X:46935440-46935462 GTTCCTAACAGGCCACAGACTGG - Intronic
1190217346 X:48488786-48488808 GACCCTAAGAGAACACATCCCGG + Intergenic
1190299630 X:49049451-49049473 GCTCCTAACAGGCCACTGACTGG + Intergenic
1190402182 X:50048320-50048342 GTTCCTAACAGGCCACAGACTGG + Intronic
1192102263 X:68277370-68277392 GCTCCTAACAGGCCACAGACTGG + Intronic
1192295354 X:69842032-69842054 GTTCCTAACAGGCCACAGATTGG - Intronic
1192407555 X:70901709-70901731 GTTCCTAACAGGCCAGAGACAGG + Intronic
1192496690 X:71620950-71620972 GTTCCTAACAGGCCACAGACCGG + Intergenic
1192548661 X:72035856-72035878 GTTCCAAACAGGCCACAGACTGG - Intergenic
1194945594 X:100063276-100063298 GTTCCTAACAGACCACAGACTGG - Intergenic
1195423330 X:104699579-104699601 GGTCCTAACAGGCCACTGACTGG + Intronic
1195493250 X:105498847-105498869 GTTCCCAAAAGGCCACAGACTGG - Intronic
1195656231 X:107333970-107333992 GTTCCTAACAAGCCACAGACTGG + Intergenic
1195768833 X:108327079-108327101 GTTCCTAACAGGCCACAGACAGG - Intronic
1195922379 X:109996399-109996421 GTTCCTAACAGGCCACAGACTGG + Intergenic
1196754444 X:119145549-119145571 GTTCCTAACAGGCTACAGACTGG - Intronic
1197641711 X:128975231-128975253 GTTCCTAACAGGCCACGGTCTGG + Intergenic
1197840846 X:130744801-130744823 GTTCCTAACAGGCCACGGACCGG - Intronic
1197982142 X:132228283-132228305 GTTCCTAACAGGCCACAGACCGG - Intergenic
1198271076 X:135056416-135056438 GTTCCCAACAGGCCACAGACTGG + Intergenic
1198522952 X:137471257-137471279 GATCCTGAGAGACCAGTGCCTGG + Intergenic
1198617680 X:138477545-138477567 GTTCCTAACAGGCCACAGACTGG + Intergenic
1198791825 X:140354639-140354661 GTTCATCAGAGGCCACATCCTGG + Intergenic
1199283955 X:146035748-146035770 GTTCCTAACAGGCCACGGACTGG - Intergenic
1199602724 X:149552210-149552232 GATCCTGAGAGGCCACGGGGAGG - Intergenic
1199647665 X:149927265-149927287 GATCCTGAGAGGCCACGGGGAGG + Intergenic
1199659929 X:150038571-150038593 GTTCCTAACAGGCCACGGACTGG + Intergenic
1199676571 X:150194688-150194710 GTACCTGAGAGCCCACAGCCAGG + Intergenic
1200368507 X:155694929-155694951 GTTCCTAACAGGCCACAGACTGG + Intergenic
1201238852 Y:11938490-11938512 GTTCCTAACAAGCCACAGACAGG - Intergenic
1201589816 Y:15602820-15602842 GTTCCTAACAGGCCACAGACTGG - Intergenic
1201694161 Y:16806474-16806496 GTTCCTACGAGGCCACAGACTGG - Intergenic