ID: 1008132585

View in Genome Browser
Species Human (GRCh38)
Location 6:47735738-47735760
Sequence ATATATACCCAGAAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008132585_1008132589 -2 Left 1008132585 6:47735738-47735760 CCATCCAACTTCTGGGTATATAT No data
Right 1008132589 6:47735759-47735781 ATCTGAAAAAATTGAAAGTGGGG No data
1008132585_1008132588 -3 Left 1008132585 6:47735738-47735760 CCATCCAACTTCTGGGTATATAT No data
Right 1008132588 6:47735758-47735780 TATCTGAAAAAATTGAAAGTGGG No data
1008132585_1008132587 -4 Left 1008132585 6:47735738-47735760 CCATCCAACTTCTGGGTATATAT No data
Right 1008132587 6:47735757-47735779 ATATCTGAAAAAATTGAAAGTGG No data
1008132585_1008132590 25 Left 1008132585 6:47735738-47735760 CCATCCAACTTCTGGGTATATAT No data
Right 1008132590 6:47735786-47735808 ATACCAATTCTGTTTACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008132585 Original CRISPR ATATATACCCAGAAGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr