ID: 1008132586

View in Genome Browser
Species Human (GRCh38)
Location 6:47735742-47735764
Sequence TCAGATATATACCCAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6115
Summary {0: 4, 1: 46, 2: 285, 3: 1265, 4: 4515}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008132586_1008132587 -8 Left 1008132586 6:47735742-47735764 CCAACTTCTGGGTATATATCTGA 0: 4
1: 46
2: 285
3: 1265
4: 4515
Right 1008132587 6:47735757-47735779 ATATCTGAAAAAATTGAAAGTGG No data
1008132586_1008132588 -7 Left 1008132586 6:47735742-47735764 CCAACTTCTGGGTATATATCTGA 0: 4
1: 46
2: 285
3: 1265
4: 4515
Right 1008132588 6:47735758-47735780 TATCTGAAAAAATTGAAAGTGGG No data
1008132586_1008132592 28 Left 1008132586 6:47735742-47735764 CCAACTTCTGGGTATATATCTGA 0: 4
1: 46
2: 285
3: 1265
4: 4515
Right 1008132592 6:47735793-47735815 TTCTGTTTACAACTGGTAAGAGG No data
1008132586_1008132590 21 Left 1008132586 6:47735742-47735764 CCAACTTCTGGGTATATATCTGA 0: 4
1: 46
2: 285
3: 1265
4: 4515
Right 1008132590 6:47735786-47735808 ATACCAATTCTGTTTACAACTGG No data
1008132586_1008132589 -6 Left 1008132586 6:47735742-47735764 CCAACTTCTGGGTATATATCTGA 0: 4
1: 46
2: 285
3: 1265
4: 4515
Right 1008132589 6:47735759-47735781 ATCTGAAAAAATTGAAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008132586 Original CRISPR TCAGATATATACCCAGAAGT TGG (reversed) Intergenic
Too many off-targets to display for this crispr