ID: 1008132588

View in Genome Browser
Species Human (GRCh38)
Location 6:47735758-47735780
Sequence TATCTGAAAAAATTGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008132586_1008132588 -7 Left 1008132586 6:47735742-47735764 CCAACTTCTGGGTATATATCTGA 0: 4
1: 46
2: 285
3: 1265
4: 4515
Right 1008132588 6:47735758-47735780 TATCTGAAAAAATTGAAAGTGGG No data
1008132585_1008132588 -3 Left 1008132585 6:47735738-47735760 CCATCCAACTTCTGGGTATATAT No data
Right 1008132588 6:47735758-47735780 TATCTGAAAAAATTGAAAGTGGG No data
1008132584_1008132588 1 Left 1008132584 6:47735734-47735756 CCAGCCATCCAACTTCTGGGTAT No data
Right 1008132588 6:47735758-47735780 TATCTGAAAAAATTGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008132588 Original CRISPR TATCTGAAAAAATTGAAAGT GGG Intergenic
No off target data available for this crispr