ID: 1008135749

View in Genome Browser
Species Human (GRCh38)
Location 6:47774816-47774838
Sequence AACCCTCTGCTGATAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008135749_1008135753 13 Left 1008135749 6:47774816-47774838 CCTTTCATTATCAGCAGAGGGTT No data
Right 1008135753 6:47774852-47774874 GCTTTGCTAAGAAGGACTTTTGG No data
1008135749_1008135754 20 Left 1008135749 6:47774816-47774838 CCTTTCATTATCAGCAGAGGGTT No data
Right 1008135754 6:47774859-47774881 TAAGAAGGACTTTTGGATGTAGG No data
1008135749_1008135752 5 Left 1008135749 6:47774816-47774838 CCTTTCATTATCAGCAGAGGGTT No data
Right 1008135752 6:47774844-47774866 ACTTGATTGCTTTGCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008135749 Original CRISPR AACCCTCTGCTGATAATGAA AGG (reversed) Intergenic
No off target data available for this crispr