ID: 1008135752

View in Genome Browser
Species Human (GRCh38)
Location 6:47774844-47774866
Sequence ACTTGATTGCTTTGCTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008135749_1008135752 5 Left 1008135749 6:47774816-47774838 CCTTTCATTATCAGCAGAGGGTT No data
Right 1008135752 6:47774844-47774866 ACTTGATTGCTTTGCTAAGAAGG No data
1008135748_1008135752 6 Left 1008135748 6:47774815-47774837 CCCTTTCATTATCAGCAGAGGGT No data
Right 1008135752 6:47774844-47774866 ACTTGATTGCTTTGCTAAGAAGG No data
1008135744_1008135752 27 Left 1008135744 6:47774794-47774816 CCAGTGTTTAGATCAGGTGGCCC No data
Right 1008135752 6:47774844-47774866 ACTTGATTGCTTTGCTAAGAAGG No data
1008135746_1008135752 7 Left 1008135746 6:47774814-47774836 CCCCTTTCATTATCAGCAGAGGG No data
Right 1008135752 6:47774844-47774866 ACTTGATTGCTTTGCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008135752 Original CRISPR ACTTGATTGCTTTGCTAAGA AGG Intergenic
No off target data available for this crispr