ID: 1008135753

View in Genome Browser
Species Human (GRCh38)
Location 6:47774852-47774874
Sequence GCTTTGCTAAGAAGGACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008135749_1008135753 13 Left 1008135749 6:47774816-47774838 CCTTTCATTATCAGCAGAGGGTT No data
Right 1008135753 6:47774852-47774874 GCTTTGCTAAGAAGGACTTTTGG No data
1008135748_1008135753 14 Left 1008135748 6:47774815-47774837 CCCTTTCATTATCAGCAGAGGGT No data
Right 1008135753 6:47774852-47774874 GCTTTGCTAAGAAGGACTTTTGG No data
1008135746_1008135753 15 Left 1008135746 6:47774814-47774836 CCCCTTTCATTATCAGCAGAGGG No data
Right 1008135753 6:47774852-47774874 GCTTTGCTAAGAAGGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008135753 Original CRISPR GCTTTGCTAAGAAGGACTTT TGG Intergenic
No off target data available for this crispr