ID: 1008136979

View in Genome Browser
Species Human (GRCh38)
Location 6:47788280-47788302
Sequence TACCAGGTAGAGCACCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008136979 Original CRISPR TACCAGGTAGAGCACCTTAG GGG (reversed) Intronic
915016071 1:152735265-152735287 AACCAGGCACAGAACCTTAGGGG - Intergenic
920254003 1:204642049-204642071 GACCAGGTAAAGCAGCTTGGAGG + Intronic
923302537 1:232655285-232655307 CACCTGGAAGAGCCCCTTAGAGG + Intergenic
1064608614 10:17072990-17073012 TACTAAGTAGAGCATCTTATGGG - Intronic
1066071207 10:31815351-31815373 TGCCAGATAGAGCACTGTAGAGG - Intronic
1068897659 10:62225288-62225310 TACCAGCTAGAGCACCCAGGTGG + Intronic
1070793694 10:79204591-79204613 CACCAGGTTGAGCTCCTTGGGGG + Intronic
1078418364 11:11184757-11184779 TACCAGGTGGAGGTCATTAGAGG - Intergenic
1086123108 11:83321012-83321034 TACCATGGAGAGCAGTTTAGAGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1091680851 12:2525465-2525487 TCCCAGGAAGAGCCCCTCAGAGG - Intronic
1098417092 12:70246432-70246454 TACCAGGTAGGGCAGTTTAGGGG + Intronic
1100717749 12:97323688-97323710 TACAAGCTAGGGCCCCTTAGGGG - Intergenic
1129570752 15:76681769-76681791 TAACAGGGAGAGCTGCTTAGAGG + Intronic
1129665821 15:77578808-77578830 TGCCAGGAGGAGCTCCTTAGTGG - Intergenic
1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG + Intronic
1154437064 18:14353635-14353657 AATCAGGGAGAGCACTTTAGAGG + Intergenic
1156518272 18:37699247-37699269 TTCCAGGTGGAGCATCTTGGAGG + Intergenic
1160938864 19:1610625-1610647 TCCAAGGGAGAGCAGCTTAGGGG + Exonic
1165967013 19:39590445-39590467 TACCACGGACAGCACCTTAGAGG - Intergenic
1167453994 19:49588994-49589016 TAACAGGTGCAGCACCTGAGTGG + Intronic
928125019 2:28609386-28609408 TACCAGATAGAGCATCCAAGGGG - Intronic
930894769 2:56432829-56432851 TACCAGGGAGAGCAGTTTGGAGG - Intergenic
934488741 2:94742613-94742635 AATCAGGGAGAGCACTTTAGAGG - Intergenic
942964616 2:181876552-181876574 TGCCAGTTTGGGCACCTTAGTGG + Intergenic
944090040 2:195897082-195897104 TACCAGGTAGAAGAACTCAGAGG - Intronic
948952971 2:241266763-241266785 TACCAGGAAGAGCACATAAAAGG + Intronic
1172836137 20:37874374-37874396 TTCCAGGTAGAGGAGCTCAGCGG - Intergenic
1176839974 21:13832007-13832029 AATCAGGGAGAGCACTTTAGAGG - Intergenic
1179429554 21:41310578-41310600 ACCCAGACAGAGCACCTTAGTGG - Intronic
1182426134 22:30273789-30273811 AGCCAGGCAGAGCCCCTTAGCGG + Intergenic
954090415 3:48279556-48279578 TACCAGTTTTAGCATCTTAGTGG + Intronic
954598422 3:51847763-51847785 TACCAGACAGAGCAACTTAAAGG + Intergenic
958921249 3:100108290-100108312 TCCAAGGTATAGCACCATAGTGG + Intronic
959129369 3:102334285-102334307 TACCAGGTGGTGCTCCATAGTGG - Intronic
968832730 4:2941545-2941567 GCCCAGGCAGAGCACCCTAGTGG + Intronic
973843316 4:54885307-54885329 TACCAGGTAGGGCTCCACAGAGG + Intergenic
979343880 4:119562293-119562315 TACCAGTTAGAACAGCTTAGTGG + Intronic
984395812 4:179198538-179198560 TACCTGGTAGAGCTCATTAATGG - Intergenic
993406043 5:87512711-87512733 AACAAGGTAAAGCAGCTTAGTGG + Intergenic
1004166208 6:13258762-13258784 TACCTGGTAGAGCTCTTTATTGG + Intronic
1004323401 6:14651473-14651495 TACCAATTAGAGCCCCTTAGAGG + Intergenic
1006126061 6:31839053-31839075 GACCAGCTTGAGCACCATAGTGG - Intronic
1008136979 6:47788280-47788302 TACCAGGTAGAGCACCTTAGGGG - Intronic
1009743114 6:67773880-67773902 TAACACGTACAGCACCTTTGGGG - Intergenic
1010981025 6:82369721-82369743 TACCTTGTTGAGGACCTTAGAGG + Exonic
1014805922 6:125829306-125829328 TAGGAGTTAGAGCACCTTGGTGG + Intronic
1015912825 6:138185658-138185680 TACAAGGTATGGGACCTTAGAGG + Intronic
1021244228 7:18242033-18242055 ACACAGGTAGAGCACCCTAGTGG - Intronic
1023390027 7:39700858-39700880 TACCAGATAAAGTACCTCAGTGG + Intronic
1023427498 7:40054068-40054090 TTCCAGGTAGAGAACTCTAGGGG + Intronic
1023971536 7:44994853-44994875 GACCAGGGAGAGCACCCCAGAGG + Intergenic
1024688421 7:51773428-51773450 TACCAAGAAGAGCACCCTAAGGG - Intergenic
1027988122 7:85321338-85321360 TACAAGGAAGAGCACATGAGAGG - Intergenic
1031588146 7:123557617-123557639 TACCGGGTAGGGCAGGTTAGTGG - Exonic
1032574330 7:133035963-133035985 TATCAGGTAGGGGTCCTTAGGGG + Intronic
1037059758 8:14493021-14493043 AATCAGGGAGAGCACTTTAGAGG - Intronic
1037725636 8:21480519-21480541 TGCCAGGTAGAGGTCATTAGGGG + Intergenic
1042379041 8:68091884-68091906 TATCTGGTAGAGCATGTTAGTGG - Intronic
1053669041 9:40341744-40341766 AATCAGGGAGAGCACTTTAGAGG + Intergenic
1053918841 9:42968003-42968025 AATCAGGGAGAGCACTTTAGAGG + Intergenic
1054380178 9:64481782-64481804 AATCAGGGAGAGCACTTTAGAGG + Intergenic
1054515570 9:66034548-66034570 AATCAGGGAGAGCACTTTAGAGG - Intergenic
1056073374 9:83012340-83012362 TTCCAGGAAGAGCAGCTTAAAGG - Intronic
1057426137 9:94951301-94951323 TACTAAGTGGAGAACCTTAGAGG - Intronic
1060052508 9:120387294-120387316 TCCCAGGTAGAGGTCCTTGGGGG + Intergenic
1188715991 X:33459601-33459623 TACCAGGTATAGTACCTGATAGG - Intergenic
1192119686 X:68443475-68443497 AAACAGGTAGAGTAACTTAGTGG - Intergenic
1194339005 X:92686331-92686353 TACAAGGTAGAGTAACTTAGAGG + Intergenic
1196438219 X:115693921-115693943 TACCAGGTGGAGGACGTTAAGGG - Intergenic
1200647398 Y:5803114-5803136 TACAAGGTAGAGTAACTTAGAGG + Intergenic