ID: 1008140449

View in Genome Browser
Species Human (GRCh38)
Location 6:47825762-47825784
Sequence TTATGGGGAAGAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 1, 2: 4, 3: 88, 4: 753}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008140441_1008140449 1 Left 1008140441 6:47825738-47825760 CCCCTATTTTTTCTGTAAAAGGC 0: 1
1: 0
2: 5
3: 27
4: 343
Right 1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG 0: 1
1: 1
2: 4
3: 88
4: 753
1008140443_1008140449 -1 Left 1008140443 6:47825740-47825762 CCTATTTTTTCTGTAAAAGGCTT 0: 1
1: 0
2: 3
3: 43
4: 491
Right 1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG 0: 1
1: 1
2: 4
3: 88
4: 753
1008140442_1008140449 0 Left 1008140442 6:47825739-47825761 CCCTATTTTTTCTGTAAAAGGCT 0: 1
1: 0
2: 7
3: 44
4: 473
Right 1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG 0: 1
1: 1
2: 4
3: 88
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008140449 Original CRISPR TTATGGGGAAGAAGGGAAGA AGG Intronic
901519079 1:9768958-9768980 AAAGGGGGAAGGAGGGAAGAAGG + Intronic
901722644 1:11212303-11212325 AGCTGGGGAAGAAGGTAAGATGG - Exonic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902998903 1:20250344-20250366 TTTTTGGGAGAAAGGGAAGAAGG + Intergenic
903406733 1:23103805-23103827 TTATTGGGAAGGAGGGAGGGAGG + Intronic
903610614 1:24608997-24609019 TTGGAGGGAAGAAGGGGAGATGG + Exonic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
904138501 1:28332817-28332839 ATATGGAGAAGAGAGGAAGAAGG + Intronic
904663774 1:32104470-32104492 TTATGGCGAAGAAGGGCTCAGGG - Intergenic
904833644 1:33321097-33321119 ATATGGGGAAGCAGGTAGGATGG + Exonic
904961716 1:34338579-34338601 GTAGGGGGAGGAAAGGAAGAGGG - Intergenic
905775329 1:40664490-40664512 TTATCAGGATGTAGGGAAGAAGG - Intronic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
906236946 1:44217773-44217795 GTCTGTGGAAGAAGGGAGGAAGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
907065853 1:51482292-51482314 GTATGGGGAAGATGGGGAGAGGG + Intronic
907074303 1:51564786-51564808 TTGAGTGGAACAAGGGAAGATGG - Intergenic
907708087 1:56850094-56850116 AAATGGTGAAGAAGGGACGATGG + Intergenic
907718621 1:56951028-56951050 TGTTGGGGAGGAAGGGAAGGAGG + Intronic
907935884 1:59041926-59041948 TTGTGGGGAAGAGGGGGAGGTGG + Intergenic
907981763 1:59489360-59489382 GTAGAGGGAAGAGGGGAAGAGGG - Intronic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908262433 1:62349480-62349502 TTGTGGGGGAGAAGTGAAGAGGG + Intergenic
908320414 1:62972959-62972981 TTAAGAGGAAGTAGGGGAGAGGG - Intergenic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
910011257 1:82465591-82465613 GTATGGGGAAGAGAGGAAGCAGG - Intergenic
910040616 1:82847243-82847265 TTATTGGGAAGAAAAGAAAAAGG + Intergenic
910076805 1:83290409-83290431 TAATGGGGAATAAGAGAATATGG - Intergenic
910258795 1:85276438-85276460 TAATGGGGAAGAAGGAGAGGAGG + Exonic
910369301 1:86498903-86498925 TTAGGGGGCAGAAGGCAGGAGGG + Intronic
910560501 1:88584848-88584870 TTATTGATAAGAAGGAAAGAAGG - Intergenic
910911359 1:92237711-92237733 TTATGGGGGAGGAGCCAAGATGG - Intronic
911214027 1:95172554-95172576 TGATGAGGAAGAAGGAAGGAGGG - Intronic
911583446 1:99662054-99662076 TAATGGGGAAGAAGGAAAAGGGG + Intronic
911962529 1:104324188-104324210 TAATAGGGAATAGGGGAAGAAGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912571533 1:110627861-110627883 TGATGGGGACAAAGTGAAGAGGG + Intronic
912699244 1:111864167-111864189 GGATGGGGAAGAAGAGAAGAAGG + Intronic
912829641 1:112941033-112941055 AGATGGGGGAGAAGTGAAGAGGG + Intronic
912967361 1:114248308-114248330 GTCTGGGGAAGAAGGAAAGAAGG - Intergenic
913169827 1:116221984-116222006 TTAAAGGGAAGAGGGGAGGAGGG + Intergenic
913301872 1:117379633-117379655 CTAGGGGGAAGCAGGGAGGAGGG - Intronic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
914876683 1:151517477-151517499 TTGGTGGGAGGAAGGGAAGAAGG + Intronic
914972689 1:152325180-152325202 TTTTGGTGAACAAGGTAAGAAGG - Exonic
915041744 1:152973584-152973606 TTAAGGGGAAGTAGAGAAGGTGG - Intergenic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915472767 1:156135834-156135856 GTATGGGGAAGGAGGGACGTGGG - Intronic
916123169 1:161547338-161547360 TTTGGGGGAAGAAGGGCATAAGG - Intronic
916133061 1:161628696-161628718 TTTGGGGGAAGAAGGGCATAAGG - Intronic
916168889 1:161986057-161986079 TTATGGAGGAGGTGGGAAGAGGG + Intronic
916287187 1:163121099-163121121 TACTGGGGTAGGAGGGAAGAAGG + Intronic
917265582 1:173217299-173217321 TGAAGGGGCAGAAGGAAAGAAGG - Intergenic
917908854 1:179618911-179618933 CTATTGGGATGAGGGGAAGAAGG - Intronic
917952854 1:180058548-180058570 TTCTGGGGAAGAGAGGAAGGAGG + Intronic
918018232 1:180659269-180659291 TGATGGGAAAGAAGGGAGGGAGG - Intronic
918076247 1:181173582-181173604 TTCTGGGGAAGAGAGGAAGCAGG + Intergenic
918543268 1:185654444-185654466 ATAGGGGTAAGAAGGGAGGAAGG - Intergenic
919019661 1:192087975-192087997 TGTTGGGGTAGCAGGGAAGAAGG + Intergenic
919494207 1:198243470-198243492 TCATAGGGAAGTAGGGGAGATGG + Intronic
919753482 1:201052738-201052760 TTTTGGGGAAGTAGGGGCGAAGG - Intronic
919881454 1:201903772-201903794 TTTTGGGAAAGGAAGGAAGAGGG - Intronic
919964958 1:202513650-202513672 TTCTGGGGAAGAAAAGAAGTTGG - Intronic
920511695 1:206556852-206556874 GGATGGGGGAGAAGGGAGGAGGG + Intronic
920696686 1:208186179-208186201 TAATGGTGGAGAAGGAAAGATGG - Intronic
920914956 1:210251962-210251984 TCCTGGGGCGGAAGGGAAGAGGG - Intergenic
921066839 1:211629321-211629343 GAATGGTGAAAAAGGGAAGATGG + Intergenic
921391233 1:214616192-214616214 TTAGGGGGAAGAAGAAAAAATGG + Intronic
921694379 1:218190777-218190799 TTTTGGGGAAGGGAGGAAGATGG + Intergenic
921764869 1:218959708-218959730 TTTTGGTGAAGAAGAGTAGATGG + Intergenic
922094439 1:222430889-222430911 TTAGGGGGAAAAATGGAAGGTGG + Intergenic
922752933 1:228079330-228079352 GTCTGGGGAAGAAGGAAACAGGG + Intergenic
923011644 1:230092838-230092860 TTAGGGGGTAGAGGGGATGAGGG + Intronic
923339533 1:232995842-232995864 TTATAGGAAGAAAGGGAAGAAGG + Intronic
923381823 1:233428035-233428057 CTATGAAGAAGAAGGAAAGAGGG - Intergenic
923496644 1:234531416-234531438 CCATGGGGAAGAAGGGGAGGTGG - Intergenic
924411050 1:243806065-243806087 TTTTGGGTGAGAAGGGAAGAAGG - Intronic
924749911 1:246876907-246876929 TTATGGGGGATAAGAGAATAAGG - Intronic
1064137571 10:12764028-12764050 TCCTGGGGGAGGAGGGAAGACGG - Intronic
1064686337 10:17866263-17866285 GAAAGGGGAGGAAGGGAAGAAGG + Intronic
1064916659 10:20465811-20465833 TTATGGTGGAGAAGCCAAGATGG - Intergenic
1065132108 10:22632756-22632778 TTATGGGGAAAAAAGGTAGGGGG + Intronic
1067172866 10:43922289-43922311 GTTTGGGGAGGAAGGGAGGAAGG - Intergenic
1067181202 10:43987206-43987228 TCAATGGGAAGAAGGGAAGGAGG + Intergenic
1067559977 10:47298440-47298462 TTCTGGGGGGGAAGGGGAGAGGG + Intergenic
1067791499 10:49291829-49291851 TTATGGGGAAGAAAGAAAACAGG - Intergenic
1067901976 10:50251354-50251376 TCTTGGGGAAGGAGGGAAGGAGG - Intergenic
1068061089 10:52068377-52068399 TTAGGGGAAAGAAAGGAAGGTGG - Intronic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1068485824 10:57657197-57657219 TTAGAAGGAAGAAAGGAAGAAGG + Intergenic
1068589111 10:58835281-58835303 TCATGGTGAAAATGGGAAGATGG + Intergenic
1068913850 10:62407234-62407256 CTATGGGGAAGCAGGTCAGAGGG - Intronic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070378580 10:75858374-75858396 AGAGGGGGAAGAAGAGAAGATGG - Intronic
1071207827 10:83302407-83302429 TGATGGGGAAGAAGAGAGGAGGG - Intergenic
1071492670 10:86146643-86146665 ATATGAGGAAGGAAGGAAGAGGG - Intronic
1071854977 10:89614914-89614936 TTAGGGAGAGGAAGGGAGGAAGG + Intronic
1071949099 10:90682712-90682734 GGAAGGGGAAGAAGTGAAGAAGG - Intergenic
1071968180 10:90874075-90874097 TTTGAGGGAGGAAGGGAAGAAGG + Intronic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1073886219 10:108042957-108042979 TGAGGGGGAGGAAGGGGAGAAGG - Intergenic
1073912499 10:108362759-108362781 TAATTGGGAAGTAGGGAAAAAGG + Intergenic
1074369577 10:112889115-112889137 TTGTGGAGAAGAATAGAAGAAGG - Intergenic
1074440184 10:113471217-113471239 TCAGAGGGAAGAAAGGAAGAGGG - Intergenic
1074499489 10:114010713-114010735 AAATGGTGAAGAAGGGAAAAGGG + Intergenic
1074561881 10:114542513-114542535 TTAGAAGGAAGAAAGGAAGAAGG + Intronic
1074643330 10:115414361-115414383 GTAAGGGGAAGAAGAGAAGAGGG - Intronic
1075066397 10:119291728-119291750 TGAAGAGGAAGAAGAGAAGAAGG - Intronic
1075366202 10:121892393-121892415 ATTTGGGGGAGAAGGGAGGAGGG + Intronic
1076111003 10:127859644-127859666 TCTTGGGGGAGAAGGAAAGATGG - Intergenic
1077163237 11:1123060-1123082 TCAGGAGGAAGGAGGGAAGAGGG - Intergenic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077422935 11:2461434-2461456 TGCAGGGGAGGAAGGGAAGAGGG - Intronic
1077854959 11:6115395-6115417 TCATGGGGAAGATGCCAAGATGG + Intergenic
1078145238 11:8717914-8717936 AGAAGGGGGAGAAGGGAAGAAGG + Intronic
1078292340 11:10025416-10025438 TTATGGGGAAGAGGGAAAATTGG - Intronic
1078633988 11:13031712-13031734 TTATAAGGAAGAAGGGAAAAAGG - Intergenic
1079069579 11:17332400-17332422 TACTAAGGAAGAAGGGAAGAGGG + Intronic
1079142767 11:17823767-17823789 TTGTGGGGAATAAAGGAAGCTGG - Intronic
1079178567 11:18167937-18167959 TTCAGGGGAAGGATGGAAGAGGG + Intronic
1079646513 11:22869933-22869955 TTTTGGGGCAAAAGGGAAGCAGG - Intergenic
1079734114 11:23973969-23973991 TTATGAGGAAAAAGGGAGGAGGG + Intergenic
1079857417 11:25623476-25623498 TCATGTGGAAGAAGGAGAGATGG + Intergenic
1080054350 11:27890223-27890245 TGATGAGGAAGAAGAAAAGAAGG - Intergenic
1080282938 11:30579669-30579691 ATATGGGGAACAAAGGAATAAGG - Intronic
1080453645 11:32399197-32399219 TTATTGGGAAGAGAAGAAGAGGG + Intronic
1080994629 11:37583352-37583374 TTATCAGGAAGAAGTGAAAATGG - Intergenic
1081689983 11:45071303-45071325 TGATGGGGGAGAATGGAAGCGGG - Intergenic
1083143147 11:60738167-60738189 TTATGGGGATGAAGAGAGAAAGG - Intronic
1083799893 11:65040774-65040796 TTATTGGGTGGAAGGGACGAAGG + Intergenic
1083835049 11:65261228-65261250 TTAGGGGTAAGATGAGAAGAGGG - Intergenic
1083861962 11:65424972-65424994 TGAGGGTGAAGAAGGGGAGAGGG + Intergenic
1084018614 11:66403150-66403172 TTTTGGGGCAGAGGAGAAGAGGG - Intergenic
1084030525 11:66478095-66478117 TTCTGGAGATGAAGAGAAGAAGG + Intergenic
1084113085 11:67025846-67025868 TGATGGGGAAGACGGCATGAGGG + Intronic
1084284967 11:68125090-68125112 TTATGGTGCAGAAGGACAGAAGG - Intergenic
1084678182 11:70649114-70649136 ATATGGGTGAGAAGGGGAGATGG - Intronic
1085438440 11:76533243-76533265 TTATCATGAAGAAGAGAAGATGG + Intronic
1085540537 11:77264441-77264463 TTAAAGGCAAGAAGGGAAGAAGG + Intronic
1085567848 11:77530915-77530937 AAAAGGGGAGGAAGGGAAGAGGG - Intronic
1085778094 11:79383998-79384020 CCATGGGGAAGAAAGGAAGGGGG - Intronic
1085989540 11:81825271-81825293 TGAGGGGGAAGGAGGGAGGAAGG + Intergenic
1087793021 11:102427369-102427391 CTATGAGGAACAAGGGGAGAAGG + Intronic
1087947512 11:104181501-104181523 TTATGGGAAAGTAGGGGAGGTGG - Intergenic
1088194833 11:107262795-107262817 TCATGCAGAAGTAGGGAAGAAGG + Intergenic
1088348557 11:108858560-108858582 AGATGGGGTAGAAGGGAAGTAGG - Intronic
1088750885 11:112841350-112841372 ATTTGGGGAAGAGGGGAAAATGG + Intergenic
1088771806 11:113042959-113042981 TGATGAGGAAGAAGAGAAGGAGG - Intronic
1088926538 11:114308513-114308535 GTATGGGGAGGAAGGGAGGGAGG - Intronic
1089032800 11:115350382-115350404 TTAAAGGGAAGGAGGGAAGAAGG + Intronic
1089067295 11:115671420-115671442 AAATGAGGAAGAGGGGAAGAAGG - Intergenic
1089158169 11:116417670-116417692 GGATGGGAAAGAATGGAAGAAGG + Intergenic
1089187075 11:116625389-116625411 TTAGGGAGAAGGAGGGAAGAAGG - Intergenic
1089299947 11:117492589-117492611 TTTTGGGGGAGAAGGGGAGTGGG - Intronic
1089905841 11:122037678-122037700 TTAAAGGGAAGAAAGGAAAAGGG + Intergenic
1090050971 11:123379024-123379046 TAAAGAGGAACAAGGGAAGATGG + Intergenic
1090315731 11:125786333-125786355 TCATGGGGTAGGAGAGAAGAAGG - Intergenic
1090537585 11:127661297-127661319 TTGTGGGGAAGAGTGGAAGTGGG - Intergenic
1090623637 11:128585758-128585780 TTTTAGAGATGAAGGGAAGAAGG + Intronic
1090843798 11:130514687-130514709 TGATAGGGGAGATGGGAAGAAGG - Intergenic
1091250394 11:134139479-134139501 GCCTGGGGAAGAGGGGAAGATGG + Intronic
1091355083 11:134931407-134931429 TTATGGAGTAGAAGGGATGGTGG + Intergenic
1091382477 12:71008-71030 TTATGTGGAAGAAGGATAGAAGG - Intronic
1091808182 12:3371468-3371490 TTTTTGGAAAGAAGGGAATAAGG + Intergenic
1091856014 12:3740997-3741019 CCATGGAGAAGAAAGGAAGAAGG - Intronic
1092802022 12:12177959-12177981 ATACAGGGAAGAAGGAAAGAAGG + Intronic
1092968457 12:13668882-13668904 TTATGTGTGAGAAGGAAAGAAGG + Intronic
1092981227 12:13796397-13796419 TCAGGGGGAAGAAGGCCAGAGGG + Intronic
1093682065 12:22014139-22014161 TTCTGTGGGGGAAGGGAAGAGGG - Intergenic
1093931257 12:24956974-24956996 GTAGGGGGAGGAAAGGAAGAAGG - Intergenic
1093952115 12:25174955-25174977 TTGTGGGGAAGAGTGGAAGGAGG + Intronic
1093967712 12:25345023-25345045 TGGGGGGGAAGTAGGGAAGAAGG + Intergenic
1094002542 12:25710955-25710977 TGATGGGAAAGAAAAGAAGATGG + Intergenic
1094124623 12:27010801-27010823 TTCTGGGTAAGAATGGAAGATGG - Intronic
1094130149 12:27065923-27065945 AGATGGGGAAGAATGGAAGAAGG + Intronic
1094173456 12:27518834-27518856 CTATGGGCAAGAAGGGAATGGGG + Intergenic
1096046001 12:48562988-48563010 TTATGGGGAAAAAAGGAGGGAGG + Intergenic
1096125185 12:49113959-49113981 TTTTGGGGAAGAAAAGAAGGGGG - Intergenic
1096876666 12:54634977-54634999 GTTTGGGGAAGAAGGGGAGGAGG - Intergenic
1097042042 12:56161608-56161630 TAAAGGGGAAGAAGGTGAGATGG + Intronic
1097056377 12:56252314-56252336 TCCTGGGGAAGAAGTGAAGGAGG + Exonic
1097296009 12:57963763-57963785 TTGTGGGGAAGAAGAGGAGGAGG + Intergenic
1097458510 12:59831897-59831919 TTACTGGGAAGAAGAGAAGGTGG - Intergenic
1098116883 12:67188378-67188400 GTACGGGAAAGAAGGGAAGAGGG + Intergenic
1098172930 12:67764944-67764966 TTATGGGGGAGGGGGGAAGTAGG + Intergenic
1098216371 12:68224577-68224599 TTATGGGAAAGAAGGAAGGAAGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098913715 12:76236102-76236124 TTTTGGGGAAAAACAGAAGAGGG + Intergenic
1099065638 12:77974887-77974909 TCAAGTGAAAGAAGGGAAGATGG - Intronic
1099277740 12:80599280-80599302 TTATGGGGAATGAGAGAATAAGG + Intronic
1099907780 12:88792258-88792280 TTATGGGGAAAAATTGAAGTTGG + Intergenic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1100241647 12:92715541-92715563 ACATGTGGAAGAAGAGAAGAGGG - Intergenic
1101744422 12:107527734-107527756 TTATGGAGAAGGAGAGATGAAGG - Intronic
1101751649 12:107586968-107586990 AAATGGGGAAGAAGGGGAAAAGG + Intronic
1102215183 12:111156227-111156249 TTCTTGGGAAGCAGGGATGAGGG - Intronic
1102411648 12:112725370-112725392 TGGTGGAGAAGAGGGGAAGAGGG + Intronic
1102729836 12:115098741-115098763 AAATGGGGAAGAAGGAAAGAAGG - Intergenic
1103082909 12:118039566-118039588 TGCAGGGGAAGAAGGGAGGATGG + Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103434635 12:120915259-120915281 GTGTGGGGAAGAGGGGATGAGGG + Intergenic
1103692156 12:122784047-122784069 TGAGGGGGAGGAAGGGATGAAGG - Intronic
1104501665 12:129292145-129292167 TCATGGGGAAAATGTGAAGAGGG - Intronic
1104884816 12:132100546-132100568 TCATGGGGCAGAAGGGCAGCTGG - Intronic
1105638804 13:22241382-22241404 TGATGGTGAAGCTGGGAAGAAGG + Intergenic
1106019435 13:25900456-25900478 TCACGTGGAAGAAGTGAAGAGGG + Intronic
1106085916 13:26541539-26541561 TTATAGGGAAGAAGGCAGGCAGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106606226 13:31231762-31231784 CTAAGGGGAAGAGGAGAAGAAGG - Intronic
1107675224 13:42789254-42789276 TGATGGGGAAGAGGAGAGGAAGG - Exonic
1108191625 13:47946465-47946487 TGTTGGGGAAGAAGTAAAGAGGG + Intronic
1111278667 13:85988777-85988799 TTATGGGGAAGGAGTGGGGAAGG + Intergenic
1111343528 13:86919008-86919030 TGATTGGCAAGAAGGGAAGATGG + Intergenic
1111427066 13:88100134-88100156 TGAGGGGGAAGAAGAAAAGACGG - Intergenic
1111669058 13:91305296-91305318 TTATGGGGGAAAAAGGCAGATGG - Intergenic
1112561827 13:100521976-100521998 TTTTGGGGAAGAAGGGTGGGTGG - Intronic
1112672114 13:101652690-101652712 AGATGGGGAAGACTGGAAGAAGG + Intronic
1113331711 13:109333856-109333878 TCATTAGGAAGAAGGAAAGAGGG - Intergenic
1113361989 13:109640263-109640285 TGATGGTGAAGGAGGCAAGAAGG - Intergenic
1113754181 13:112798054-112798076 TTATGTGGCAGAAGGCAAAAGGG + Intronic
1113774691 13:112936519-112936541 TTTTGGGGAAGAAGAGAAGGAGG + Intronic
1113784496 13:112995321-112995343 TTAAGAGAAAGAAGGAAAGAGGG + Intronic
1114254998 14:20994130-20994152 TTACTGGGAAGTAGAGAAGAGGG + Intronic
1114494482 14:23123261-23123283 TCATGGAGTAGAAGGGATGAGGG + Intergenic
1114661663 14:24350009-24350031 TATGGAGGAAGAAGGGAAGAAGG + Intergenic
1115429824 14:33303564-33303586 TTTTGGGGAACAATGGAAGATGG + Intronic
1117059576 14:51948269-51948291 TAATGAAGAAGAAAGGAAGAGGG + Intronic
1117212682 14:53517429-53517451 TTATAGGACAGAAGGGAAGCAGG + Intergenic
1118087304 14:62432264-62432286 TTATGGGAAGGAAGAAAAGATGG - Intergenic
1118399278 14:65364597-65364619 CTATGGGGGACAAGGCAAGATGG - Intergenic
1118817857 14:69325443-69325465 TTCTGGGGAAACAGGGACGAGGG - Intronic
1118846758 14:69553296-69553318 TAAGAGGGAAGAAGGGGAGATGG - Intergenic
1118916735 14:70114048-70114070 TCTTGGGGAAGAAGGTAAAAGGG - Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1119775008 14:77242882-77242904 TCCTGGGGAAGGATGGAAGAAGG - Exonic
1119976279 14:79027842-79027864 TGTGGGGGAAGAGGGGAAGAGGG - Intronic
1120159675 14:81131786-81131808 CTATGGGGAAAAGGGGAACAGGG - Intronic
1120705861 14:87744808-87744830 TAATGGGGAGGAAGTGGAGAGGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121452953 14:94021036-94021058 TGCTGGGGAAGAAGAGAATAGGG - Intergenic
1121460475 14:94072444-94072466 TTGGGGGGAAGAATGAAAGAGGG + Intronic
1121769888 14:96524505-96524527 GGAAGGGGAAGAGGGGAAGAAGG - Intronic
1121834675 14:97081102-97081124 TTTTGGGGAAGAGGGGAAGGAGG + Intergenic
1122419354 14:101565286-101565308 TGAAGGGGAAGCAGGGAGGAAGG - Intergenic
1122486407 14:102084851-102084873 TGATGAGGAAGAAGAAAAGAAGG - Exonic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1124410813 15:29435074-29435096 TGATAGGGAAGAGGGGAAAATGG - Intronic
1124546724 15:30635428-30635450 TTTTGGGGAAGAGTGGAGGAAGG + Intronic
1124780329 15:32625428-32625450 TTTTGGGGAAGAGTGGAGGAAGG + Intronic
1124960032 15:34387006-34387028 TGATGGGGAAGAAAGGAAGTCGG - Intronic
1124976661 15:34533227-34533249 TGATGGGGAAGAAAGGAAGTCGG - Intronic
1125000015 15:34759740-34759762 TGATGTGGAAGAAGAGCAGAAGG - Intergenic
1125281754 15:38049069-38049091 CTATAGAGAAGAGGGGAAGAAGG - Intergenic
1125947716 15:43723477-43723499 TTTTGGGGGAAAAGGGAAGGAGG + Intergenic
1126405599 15:48319620-48319642 TAAAGGGGAAGGAGAGAAGAGGG + Intergenic
1126471878 15:49021137-49021159 TTATGTGGTAGAAGGGGTGAAGG - Intronic
1127013279 15:54653876-54653898 TAATGGGAAAGAAGGGAAGAAGG - Intergenic
1127176760 15:56366346-56366368 TTAGGGGGAAAAGGGGAAGAGGG - Intronic
1127205841 15:56717401-56717423 TCATGAGAAAGAAGGAAAGAAGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127513385 15:59666247-59666269 TTTTGGGGAGCAGGGGAAGAAGG - Intronic
1127537239 15:59901245-59901267 CTATGGGACAAAAGGGAAGAGGG - Intergenic
1127762142 15:62149925-62149947 CCATGGGGAACAAGAGAAGAAGG - Intergenic
1128350205 15:66883434-66883456 TTGTGGGGGAGATGGGAGGAGGG - Intergenic
1128371304 15:67041334-67041356 GGAAGGGAAAGAAGGGAAGAAGG + Intergenic
1128388763 15:67168696-67168718 TTAATGAGAAGAAAGGAAGAAGG - Intronic
1128612491 15:69085135-69085157 TTTCAGGGAAGAAGGGGAGAAGG - Intergenic
1129775406 15:78233353-78233375 TTATGGGGAAGGAAGATAGAGGG - Intronic
1130054834 15:80513549-80513571 TTTTAGGAAAGAAGGGAAGAGGG - Intronic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130196766 15:81786842-81786864 TTTTGGGGCAGAAGGGACTAAGG + Intergenic
1130380962 15:83372044-83372066 GAATGGGGAAGAAGGGTAGAGGG + Intergenic
1130436610 15:83905850-83905872 GTATGGGGAAAAAGGCAAGCTGG - Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131009384 15:89004580-89004602 GAAGGGGGAAGAAGGAAAGAAGG - Intergenic
1131018284 15:89075751-89075773 GTATGGGGAAGAAGAGCAGCAGG + Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132149972 15:99452344-99452366 TGATGAGGAAGAAGGGAGGTGGG + Intergenic
1133033572 16:3022819-3022841 TTGTGGGGAAGAAGGAAGGTGGG + Exonic
1133408536 16:5548221-5548243 TGGTGGGGGAGAAAGGAAGAAGG + Intergenic
1133619220 16:7510278-7510300 TTATGGAGGAGAAAGGAAGCAGG + Intronic
1134030999 16:10992254-10992276 GGATGGGGAAGATGGGGAGAGGG - Intronic
1134229459 16:12417652-12417674 GTAAGAGGAGGAAGGGAAGAGGG - Intronic
1134444472 16:14320450-14320472 GCTTAGGGAAGAAGGGAAGAAGG - Intergenic
1134505146 16:14799360-14799382 TTATGGGTGAGTGGGGAAGAAGG - Intronic
1134575430 16:15329550-15329572 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1134656327 16:15950376-15950398 TTTGGGGGAACCAGGGAAGAAGG + Intronic
1134727015 16:16426942-16426964 TTATGGGTGAGTGGGGAAGAAGG - Intergenic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1134867112 16:17618277-17618299 TGATGAGGAGGAAGGGAAGGAGG + Intergenic
1134940422 16:18284913-18284935 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1135166817 16:20146464-20146486 TTCTTGGGAAGAAGGAAAGAAGG + Intergenic
1135991468 16:27221271-27221293 TTATGGGAAGGAAGGGCAAAAGG - Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139991794 16:70945668-70945690 TAATGAGGTAGAAGGGAAGGTGG + Intronic
1140413874 16:74759484-74759506 TTAGTGGGAAGAATGGAAAAAGG - Intronic
1140793914 16:78417610-78417632 TTGCGGGGAAGAGGGAAAGATGG - Intronic
1140998641 16:80286703-80286725 TTTTGGTGAGGAAGGGTAGAAGG + Intergenic
1141289652 16:82706043-82706065 GAATAAGGAAGAAGGGAAGAAGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141892106 16:86933191-86933213 AGATGGGGAAGAAGGGAAGGAGG + Intergenic
1142887060 17:2919535-2919557 TTGTGGGGAACACGGGAAGTGGG + Intronic
1142958256 17:3535483-3535505 GGAAGGGGAAGGAGGGAAGAAGG - Intronic
1143157290 17:4846035-4846057 TCATGGGGAAGGAGGAAAAAGGG + Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143818588 17:9540998-9541020 TTATGGGCATGAAGAGCAGAAGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144126808 17:12210507-12210529 TGAAGGGGAAGAGAGGAAGAAGG - Intergenic
1144207566 17:12989836-12989858 TTATGGGGTAGAAGCAAAGCAGG + Intronic
1144658069 17:17050769-17050791 TTTAGGGGCAGAAGGGAGGAAGG + Intronic
1145868347 17:28255039-28255061 TTATGGGGAGGGAGGAAAGGTGG + Intergenic
1147856137 17:43481589-43481611 TTATGGGGAGGAAGAGTAGGAGG + Intergenic
1148748647 17:49932119-49932141 TCACGGGGCAGAGGGGAAGATGG + Intergenic
1149330158 17:55572814-55572836 TGTTGGGGAAGAGGGGAATAGGG - Intergenic
1149345390 17:55729174-55729196 ATATGGGGAAGAGGGAAAGCAGG + Intronic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1150351076 17:64444935-64444957 TTATGGAGAAGGAGGAAAGATGG - Intergenic
1151578712 17:74965556-74965578 TTGTGGGGAAAAGGGGAAGGGGG - Intronic
1151603691 17:75122971-75122993 TTAAGATGAAGGAGGGAAGAAGG - Intronic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151991068 17:77574650-77574672 TAATGGGAATGATGGGAAGAAGG - Intergenic
1152028175 17:77825142-77825164 TTATGGGGAGGAGGGGCAGCTGG - Intergenic
1153014818 18:573968-573990 ATCTGGGAAAGAAGGGGAGAGGG + Intergenic
1153177585 18:2395701-2395723 TTCTGGGGAAGAAGAGAGGTTGG - Intergenic
1153266168 18:3271901-3271923 TGATTGGGAAGAAGAGAAAAGGG + Intronic
1153371024 18:4316404-4316426 TGATGGGGAAGATGGGAATCAGG + Intronic
1153835958 18:8964183-8964205 TTGTGGAGAATAAGGGAAAAAGG - Intergenic
1154126778 18:11698729-11698751 TCCTGGGGATGAAGAGAAGAGGG + Intronic
1155275903 18:24187232-24187254 TGAAGGGGAAGTAGGGAAGTTGG + Intronic
1155569898 18:27181914-27181936 TTGTGGGGAGGTGGGGAAGATGG - Intronic
1155966294 18:32038444-32038466 GTAATGGGAAGAAGGGAAAATGG - Intronic
1156041886 18:32832309-32832331 TAATGGAGAAAATGGGAAGAGGG - Intergenic
1156350078 18:36296291-36296313 TTTGGGGGAGGAAGGGCAGATGG - Intergenic
1156362539 18:36396759-36396781 TTATAAGGAAGAAGAGAATAAGG - Intronic
1156369074 18:36456514-36456536 TCATGGGTAAGAATGGAATAGGG + Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156698083 18:39792002-39792024 TTATGTGGAAGAAGGGAGATGGG + Intergenic
1157144139 18:45144002-45144024 TTAAAGAGAAGAAGGGAAAAGGG - Intergenic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1158265427 18:55656241-55656263 TTATGGTGGAGAAGGGTTGAGGG + Intronic
1158822251 18:61174288-61174310 TTATGTGGAAGAAGATAACATGG + Intergenic
1159476209 18:68924115-68924137 TGGGGGGGAAGAAGGGAAAAGGG - Intronic
1160872085 19:1282231-1282253 TGAAGGGGAAGGAGGGAGGAGGG + Intergenic
1161255985 19:3310021-3310043 GGAGGGGGAAGAAGGAAAGAGGG - Intergenic
1162132764 19:8537054-8537076 TTCTGAGGCAGAAGTGAAGACGG + Exonic
1162494314 19:11014593-11014615 TCCAGGGGAAGAAGGGCAGAGGG - Intronic
1162968241 19:14165761-14165783 AGATGGGGGAGAGGGGAAGACGG + Intronic
1163160929 19:15463864-15463886 TTAGGGGGAAAGAGGGAACAGGG + Intronic
1163701555 19:18789115-18789137 TTTTGGAGCAGAAGGGAAGGGGG - Intronic
1163797703 19:19346854-19346876 ATAGGGGGAAGTGGGGAAGAGGG - Intronic
1164057011 19:21630260-21630282 TTATGGGTCAGAAGGAAAGGTGG - Intergenic
1164155255 19:22591892-22591914 TTATGGGGAAGGAAGTGAGAGGG + Intergenic
1164243452 19:23410013-23410035 TGATGGGGAAGAAGGGAGGGAGG + Intergenic
1164521276 19:28982126-28982148 AGATGGGGAGGAAGGGAGGAAGG + Intergenic
1164844150 19:31417661-31417683 TTTTGGGGGAGCAGAGAAGATGG + Intergenic
1165887082 19:39085773-39085795 TCGTGGGGAAGAGGAGAAGAGGG - Intronic
1166646130 19:44533078-44533100 GGATGGGGAGGAGGGGAAGAGGG - Intergenic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1166818902 19:45564307-45564329 GTAGAGGGAAGAAGGGGAGAGGG + Intronic
1168000971 19:53445839-53445861 TTCTGGGGAACACGGGAAGCTGG - Intronic
1168075461 19:53978800-53978822 ATAAGGGGAAGAAGGGAGGGAGG + Intronic
925293989 2:2765918-2765940 GTATGGGGAAGGAGGGGACAGGG - Intergenic
925637008 2:5950204-5950226 TTATGGGGCAGTTGGGGAGATGG + Intergenic
925842252 2:8003552-8003574 TGCTGGAGAAGAAGGGAAGGAGG - Intergenic
925953738 2:8940147-8940169 TTAAGACGTAGAAGGGAAGAGGG - Intronic
927287308 2:21369986-21370008 GGAGGGGGAGGAAGGGAAGAAGG - Intergenic
927334828 2:21909326-21909348 TTATGGGGGAGGAGCCAAGATGG - Intergenic
928378222 2:30796076-30796098 TTTTGGGGAAGAAAGGAAAAGGG - Intronic
928840057 2:35595275-35595297 ACATGAAGAAGAAGGGAAGAAGG - Intergenic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
929428311 2:41866246-41866268 GTGGGAGGAAGAAGGGAAGAAGG - Intergenic
929632933 2:43484377-43484399 TTTTAGGGAAGAAGGGAATAGGG + Intronic
929801991 2:45112173-45112195 TTAGGGGGAAGTAGAGAAGGAGG + Intergenic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930110633 2:47675804-47675826 AGATGGGGAAGAAGGAAGGAGGG + Intergenic
930330867 2:49981389-49981411 TGAAGGGGAGGGAGGGAAGAGGG + Intronic
930630545 2:53749158-53749180 TAATGAGGAAAAAGGAAAGATGG + Intronic
930775771 2:55168689-55168711 TTATGGGGAAGAAGTGAGGCTGG - Intergenic
930845540 2:55899730-55899752 TACTTGGGTAGAAGGGAAGAGGG - Intronic
931493422 2:62775025-62775047 CTATGGAGAAAAAAGGAAGAGGG + Intronic
931609455 2:64082795-64082817 ATATGGGGGAGAAGTGAGGATGG - Intergenic
932519653 2:72397165-72397187 TCATGAGGAAGAAGGAAAGAAGG - Intronic
932803210 2:74761201-74761223 TTATGGGGAAGGAGGCAAAGAGG + Intergenic
933402977 2:81822222-81822244 TAATGTGGCAGAAGGGAGGAGGG - Intergenic
933812780 2:86043480-86043502 TTTCTGGGAAGAAAGGAAGAGGG + Intronic
933942400 2:87255259-87255281 TTAAGGGGAAGAAGAGAGAAAGG + Intergenic
934467971 2:94283479-94283501 TAAGAGGGAAGAAGGAAAGAAGG - Intergenic
934774872 2:96930871-96930893 TTATGTGGCAGAAGGGTAAAAGG - Intronic
935432417 2:102990357-102990379 TGATGGGCAAGGAGGGAAGGAGG + Intergenic
935652451 2:105393810-105393832 TTATCTGGAAGGAGGGACGAGGG - Intronic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936337826 2:111606310-111606332 TTAAGGGGAAGAAGAGAGAAAGG - Intergenic
936603205 2:113920631-113920653 GTAGGGGAAAGAAGGGAATAGGG - Intronic
937018688 2:118630956-118630978 CTCCAGGGAAGAAGGGAAGAAGG + Intergenic
937211754 2:120278169-120278191 TTGTGGGGTAGAGGGTAAGAGGG + Intronic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
938542510 2:132296175-132296197 TCATGAGCTAGAAGGGAAGAAGG - Intergenic
938663873 2:133513760-133513782 TTGTGGGGGAGAAGAAAAGAGGG + Intronic
938710066 2:133968650-133968672 GTATGGGGAATAGGGGAAGTAGG - Intergenic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
938890154 2:135696337-135696359 TTATGGGGAAGAAGGGAAGGTGG + Intronic
939495809 2:142926543-142926565 TTATGGGGTGATAGGGAAGAAGG + Intronic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
939922512 2:148134598-148134620 TTGGGGGGAAGAATGGAATAGGG - Intronic
940320319 2:152369985-152370007 CTATAGGGAAGAAGGGTGGATGG + Intronic
940661818 2:156554561-156554583 TTTAGGGGAAGAGGGGAAGAAGG + Intronic
940764112 2:157771397-157771419 TTAAAGAGAAGAATGGAAGAGGG - Intronic
940813715 2:158275117-158275139 TTATGAGGAAGTAGGGATGAAGG - Intronic
940987530 2:160063471-160063493 AAATGGGGAAGAAGGGAAAGTGG + Intergenic
941269662 2:163409398-163409420 TTATAGTAAACAAGGGAAGAAGG + Intergenic
941570603 2:167164997-167165019 TTATTGGGAGGAGGGGAGGAAGG - Intronic
941633295 2:167908006-167908028 GGATGGGGAAGGAGGGAAGGAGG + Intergenic
941932156 2:170952992-170953014 TGTGAGGGAAGAAGGGAAGAAGG + Intronic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942514513 2:176737862-176737884 ATATGGGATAGAAGGAAAGAAGG + Intergenic
942615018 2:177782755-177782777 AAGTAGGGAAGAAGGGAAGAGGG - Intronic
943543008 2:189241191-189241213 TTAAGGGAAAAAAGGGAAGATGG - Intergenic
943615096 2:190083539-190083561 TTATAGGCAAAAAAGGAAGACGG + Intronic
943732304 2:191315211-191315233 TTTTAGGGAGGAGGGGAAGATGG - Intronic
943921358 2:193710916-193710938 TTTTGGGGGAGAAGCCAAGATGG - Intergenic
944183928 2:196926928-196926950 TGAGGGGAAAGAAGGGAAGTGGG + Intronic
944919693 2:204399106-204399128 TTATGGGGAAGATTGGGAGGTGG + Intergenic
945008968 2:205441511-205441533 TGGTGGGGAAGAAGGGTAGCAGG + Intronic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
946036214 2:216744491-216744513 TGATGGGGAAGGGGTGAAGAAGG - Intergenic
946048050 2:216837575-216837597 TTATGGGCAGCAAGTGAAGATGG - Intergenic
946058785 2:216923683-216923705 GTAGGGGGAAGAAGGGACTAGGG - Intergenic
946204666 2:218095329-218095351 TTTTGGTGATGCAGGGAAGAAGG - Intergenic
946260846 2:218489456-218489478 TTTTGGGGGAGAAGGAAGGAGGG - Intronic
946659241 2:221981762-221981784 TTTTGGGGAAGAATGGGAGAAGG - Intergenic
946768078 2:223058759-223058781 TTGAGGGGAAGATGGGAGGAGGG + Intronic
946775927 2:223140957-223140979 TCTTGGGAAAGAGGGGAAGAAGG + Intronic
946941780 2:224776772-224776794 TGATGGGGAGGAATGAAAGAGGG - Intronic
947619025 2:231576754-231576776 TCATGGGGAAGCAGGGGAGGAGG - Intergenic
948948751 2:241235517-241235539 TTATTGGGCAGAAAGGAAGTGGG - Exonic
948952530 2:241263460-241263482 TTATGGAGAAGAACTGAGGAGGG + Intronic
948997857 2:241592873-241592895 GTACGGGGAAAAAGGGAAAATGG + Intronic
1169000335 20:2163639-2163661 GCAAGGGGAAGAAGGGAAGTCGG + Intronic
1169484261 20:6013432-6013454 AGATGGGGAAGAAGGGAGGCAGG + Intronic
1169533405 20:6509780-6509802 TTTTGGGGGTGATGGGAAGAGGG + Intergenic
1169563215 20:6824476-6824498 TTATGTGGAATAAGAGAACAAGG + Intergenic
1170270576 20:14523183-14523205 TTCTGGGGGAGAAGAGTAGAAGG - Intronic
1170604042 20:17862830-17862852 TTATGGTGAGAAAGGGAGGAAGG + Intergenic
1171003246 20:21435954-21435976 TTATGGGGCAGAGTGGCAGAGGG + Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171871390 20:30529022-30529044 TCATGAGCTAGAAGGGAAGAGGG - Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172898324 20:38316209-38316231 AAAAGGGGAAGGAGGGAAGAGGG - Intronic
1172983595 20:38964091-38964113 TTATATGGAAGTATGGAAGAGGG + Intronic
1173916174 20:46709937-46709959 TTCCGGGGCAGAAAGGAAGATGG - Intronic
1174656052 20:52173159-52173181 TTAAGTTGAAGAAGGGAAGGGGG - Intronic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1174938300 20:54896228-54896250 TTGGGGGGAAGAATGGGAGAGGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175329332 20:58152256-58152278 GTATGGTGAAGAAGAGAGGAAGG - Intronic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175594581 20:60220726-60220748 CTAGGGGGAAGAGGAGAAGAAGG - Intergenic
1175720742 20:61285462-61285484 GTATGGAGAAGAAGGAAAGAGGG + Intronic
1176012171 20:62903846-62903868 GTGTGGCAAAGAAGGGAAGAGGG + Intronic
1176282729 20:64323827-64323849 TTATGTGGAAGAAGGATAGAAGG + Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178576084 21:33792915-33792937 AAATGGAGAAGAAGGGAAGAAGG - Intronic
1178821208 21:35976889-35976911 TTCTGGGGAGGAAGGGAGGGAGG + Intronic
1178828658 21:36036453-36036475 GTTTGGGGAAGAGGGGAATAGGG - Intronic
1178985726 21:37301169-37301191 TTATGGAGTAGATGGAAAGAAGG - Intergenic
1179565593 21:42245941-42245963 TTCCGAGGAAGAAGGGAAGCCGG - Intronic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182032878 22:27173976-27173998 TTGTGGGGGAGAGGGGGAGATGG - Intergenic
1182186981 22:28414650-28414672 ATATGGGGAAGAATTGAAGAGGG + Intronic
1182298339 22:29323826-29323848 ATCTGGGGAAAAAGGGAAGTTGG + Intergenic
1183293190 22:37015304-37015326 TGAGGGTGAAGAAGGGAGGAGGG - Intronic
1183321912 22:37170046-37170068 TGATGGGGGAGAAGGAAGGAAGG + Intronic
1183355581 22:37357352-37357374 TCCTGTGGAAGAAGGGAAGGTGG + Intergenic
1183440034 22:37817928-37817950 TTGTGGGGCACAAGGGAGGATGG - Intergenic
1184287040 22:43477623-43477645 TCATGGAGCAGAGGGGAAGATGG + Intronic
1184355359 22:43975901-43975923 AGAAGGGGAAGAAGAGAAGAAGG - Intronic
1184363211 22:44030993-44031015 CTATGGGGAAGAGGGGATGGTGG + Intronic
1184768449 22:46584723-46584745 TTAGAGGGAAGAAGGGAGGGAGG + Intronic
1184919658 22:47596822-47596844 TCATGGGAGAGGAGGGAAGAGGG - Intergenic
1185097380 22:48818530-48818552 TTATGGGATAGAAGCAAAGAAGG - Intronic
1185267437 22:49911854-49911876 TGATGGGGAAAAGGGGAAGCGGG - Intronic
949359997 3:3221570-3221592 TGATGGGGATGAAGGGGAGAAGG - Intergenic
949381782 3:3454674-3454696 TTAAGAAGAAGAGGGGAAGAAGG + Intergenic
949516254 3:4809919-4809941 TTAAAGGGAAGCAAGGAAGAGGG - Intronic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
950690217 3:14650089-14650111 TTATGGAGAAAATGGGAAAAGGG - Intergenic
950725411 3:14913922-14913944 GTGTGGGGAAGAAGAGAAGCAGG - Intronic
951752545 3:26053703-26053725 TTTTGGTGATGAAGGGAAAAAGG + Intergenic
951826359 3:26873581-26873603 TTGTGGTGAAGAAGGAAAAAAGG + Intergenic
952144860 3:30521087-30521109 TGAAGGGAAAGAAGGGAAAAGGG - Intergenic
952530939 3:34261053-34261075 AAAGGAGGAAGAAGGGAAGAAGG - Intergenic
952606837 3:35157916-35157938 TCAGGGGGAAGAACCGAAGAAGG - Intergenic
952978107 3:38713494-38713516 TTATGGGTGACAAGGGAAGATGG + Intronic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953301790 3:41784458-41784480 TTAGGGGGAAAAATGGAAAAAGG + Intronic
953598247 3:44338132-44338154 TCTTGGGGAAGAAGGGGAAAGGG - Intronic
953879427 3:46683936-46683958 TCATGGGGGTAAAGGGAAGAAGG + Intronic
954441033 3:50522055-50522077 GGCTGGGGAAAAAGGGAAGAGGG - Intergenic
954673679 3:52304040-52304062 TAATCTGGAAGGAGGGAAGAGGG - Intergenic
954806857 3:53225577-53225599 TTCTGGGGAAGAAGCGTGGAGGG - Intronic
955651063 3:61194277-61194299 TTAAGGGGAGGAAGAGAAGTAGG + Intronic
955781721 3:62491795-62491817 TTAATGGGAAGAAGGGAAGTGGG - Intronic
956532098 3:70231995-70232017 CTAAGGGGAAGAAGGGTGGAAGG - Intergenic
956534228 3:70257487-70257509 GGAAGGGAAAGAAGGGAAGAAGG + Intergenic
956720136 3:72110311-72110333 AAATTGGGAAGAGGGGAAGAAGG - Intergenic
957192797 3:77031312-77031334 CAATGGGGATGATGGGAAGATGG + Intronic
957464939 3:80575990-80576012 TGATGAGGAAGAAGGGGAGGAGG + Intergenic
958558435 3:95709757-95709779 AAATGGGGAAAAAGGGAAGTTGG + Intergenic
958885161 3:99718072-99718094 TTATGGAGGAGATGGGAAGCTGG - Intronic
958912196 3:100006388-100006410 TTATGGGGAAGGAGGAAAAAAGG - Intronic
959008878 3:101050956-101050978 ATCTGGGGCAGAAGGTAAGAGGG + Intergenic
959212555 3:103406178-103406200 TTATTGGCAAGATGGAAAGAAGG + Intergenic
959893887 3:111585500-111585522 TAATAGGGATGAAGGGAAGCTGG + Intronic
960414587 3:117368611-117368633 ATATGGGGCAGAAGGGTAAAGGG + Intergenic
960438400 3:117656037-117656059 ATATGGGGAATAAAAGAAGAAGG + Intergenic
960700572 3:120435398-120435420 TGATGAGGAAGACTGGAAGAAGG - Intronic
961216092 3:125161941-125161963 TTCTTGGGAAGAAGGAAGGAAGG - Intronic
961472773 3:127126879-127126901 CTTTGTGGGAGAAGGGAAGAGGG - Intergenic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
961817214 3:129557295-129557317 TTATGTGGCAGGAGGGATGAGGG - Intronic
961863175 3:129934238-129934260 TGATGGAGAATAAGGGAGGAAGG - Intergenic
961951009 3:130749076-130749098 AGATGGAGAAGAAGGGAGGAGGG - Intergenic
962124365 3:132599666-132599688 TGATTGGGAAGCAGGGATGAAGG + Intronic
962366942 3:134793174-134793196 TTAAGGGGAGGGAGGGAAGCTGG + Intronic
962468674 3:135685867-135685889 TTAGTGGCTAGAAGGGAAGATGG + Intergenic
963550087 3:146709341-146709363 GTAAGGGGAGGAAGGAAAGAAGG - Intergenic
963602733 3:147391913-147391935 TCAGGGGGTAGAAGGAAAGAGGG - Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963642618 3:147878259-147878281 TTATGGTGAGGAAGAGAAGAAGG + Intergenic
963716135 3:148806095-148806117 TTATGTGGGGGAAGAGAAGAGGG - Intronic
963755227 3:149228095-149228117 TTATGGGGAAAAGGCCAAGAGGG + Intergenic
964527968 3:157635644-157635666 TCATTGGGAAGAAAGAAAGAAGG + Intronic
964877455 3:161384467-161384489 TGATGGGGGAGAAGGAAAGGAGG - Intergenic
965679171 3:171232744-171232766 TGAGGGAGAAGAAGGGAAGAGGG - Intronic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966666993 3:182482407-182482429 TTTTTTGGAAGAAGGGATGACGG - Intergenic
966692680 3:182758021-182758043 TTATATGGAAGGAAGGAAGAAGG + Intergenic
967209562 3:187156130-187156152 TTGAGGGGAAGAGTGGAAGAGGG + Intronic
967341635 3:188405210-188405232 GTATGTGGAAAAGGGGAAGAGGG - Intronic
967597033 3:191338146-191338168 TGATGGGGAAGCGGTGAAGAGGG - Intronic
969350843 4:6597092-6597114 TTCTGGGAGACAAGGGAAGATGG - Exonic
970029586 4:11659487-11659509 TCATGTGGAATATGGGAAGATGG - Intergenic
970174300 4:13323014-13323036 TTGTGGGGAAAAAGGTAAGCTGG - Intergenic
970444468 4:16112591-16112613 AAATGGGGAAGAAGGAAGGAAGG + Intergenic
970658145 4:18254674-18254696 TTAGGGGGAAGAATGGGAGGGGG - Intergenic
970694996 4:18666735-18666757 TGAAGGGGCAGAAGGAAAGAAGG + Intergenic
971843328 4:31884127-31884149 TTATTTGTAAGAAGGTAAGAAGG + Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
973163732 4:47051281-47051303 TTAGAGCTAAGAAGGGAAGAAGG + Intronic
973270000 4:48253293-48253315 TTATGTGGAAGCAGGGAGAAGGG - Intronic
974847853 4:67372944-67372966 TTAAAGGGAATAAGGGAACAAGG - Intergenic
974896171 4:67941803-67941825 TTATGTCTTAGAAGGGAAGAAGG + Intronic
975420616 4:74159565-74159587 TCATGGAGAAGATGGGGAGATGG - Intronic
975654049 4:76623194-76623216 TTATAGGGAAGAAGGAAGAAAGG - Intronic
975778142 4:77811565-77811587 GAATGGGGAAGAAAGGGAGAGGG + Intronic
975861402 4:78680899-78680921 TCAGGAGGAAGAAAGGAAGAGGG + Intergenic
976455756 4:85245552-85245574 TTTTGAGGAAGAAAGGAAGGGGG - Intergenic
976463217 4:85336847-85336869 TTATGCTAAAGAAGGGAATAAGG + Intergenic
976536061 4:86218847-86218869 TTGTAGGGAAGAGGGCAAGAGGG + Intronic
976554323 4:86432805-86432827 TAATGGGCAACAAGGGCAGATGG + Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977019553 4:91742603-91742625 TTGCGGGGAAGAGTGGAAGAGGG - Intergenic
977874083 4:102129015-102129037 TTCTGGGGAAGAATCCAAGAGGG + Intergenic
978264740 4:106810276-106810298 AGAGGAGGAAGAAGGGAAGAAGG - Intergenic
978815888 4:112905017-112905039 TCAAGGGGAAGGAGGGAAGAAGG + Intronic
979048105 4:115895470-115895492 TTATGGTGAAAAATGGCAGATGG + Intergenic
979546066 4:121941431-121941453 TGAAGGGCAAGAAGGGCAGATGG + Intronic
980045554 4:127984313-127984335 TTATGGGAAAGAAGACAAAAAGG - Intronic
980096609 4:128497860-128497882 GTAGGGGGAAGTAGGGAAGAGGG - Intergenic
980344591 4:131596415-131596437 AGAAAGGGAAGAAGGGAAGAAGG - Intergenic
980581443 4:134759063-134759085 TTTTGGGGAAAAAAGGAAGGAGG - Intergenic
980741714 4:136958405-136958427 TGATGGGAAAGCAGGGAATAAGG - Intergenic
981282836 4:142979237-142979259 TTATGGGAAAGAATTGAAAAAGG + Intergenic
981389191 4:144168626-144168648 AGAAGGGGGAGAAGGGAAGAGGG + Intergenic
981425650 4:144600112-144600134 GTAAGGGGAAAAAGGGAATAAGG + Intergenic
981428239 4:144628786-144628808 TTATGTCCCAGAAGGGAAGAAGG + Intergenic
982361404 4:154523540-154523562 TTAGGGGGCGGTAGGGAAGACGG - Intergenic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
983427311 4:167602065-167602087 TTACATGGAAGAAAGGAAGAAGG - Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
984095711 4:175430018-175430040 TATAAGGGAAGAAGGGAAGATGG + Intergenic
985113256 4:186567433-186567455 ATATGGGGAAGCTGGGAGGAAGG - Intergenic
986578820 5:9242609-9242631 TTATGGGGAAGAGTGGGAGCGGG + Intronic
986632435 5:9786837-9786859 ATGTGGGGAAGAATGGAAGGTGG - Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987185620 5:15415331-15415353 TTAGGGGGAAGAGTGGGAGAGGG + Intergenic
987353899 5:17045542-17045564 TTATGGGGAATAATGGAAAAAGG - Intergenic
987588980 5:19897935-19897957 TTATCTGGATGAAGGGAACATGG + Intronic
987653131 5:20770738-20770760 TTACGTGGCAGAAGGAAAGAAGG + Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
988148497 5:27344101-27344123 TATTGGGGAAAATGGGAAGAAGG + Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
988432207 5:31132299-31132321 TGATAGAGAAGAAGGGAAAAGGG + Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988742442 5:34090746-34090768 TTACGTGGCAGAAGGAAAGAAGG - Intronic
988982819 5:36588468-36588490 TTATGGTGGAGAAAGGAAGAGGG - Intergenic
990370848 5:55116745-55116767 TTATGATGAAGAAGAGAAAAAGG + Intronic
992081025 5:73234312-73234334 TGATGGGGGAGGAGGGATGAAGG - Intergenic
992174672 5:74138148-74138170 TACTGAGGAAGAAGTGAAGAGGG + Intergenic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
993134612 5:83943376-83943398 TTTTAGGGAAATAGGGAAGAGGG + Exonic
993432809 5:87852647-87852669 TTATTGAGGAGAAAGGAAGATGG + Intergenic
993674636 5:90802219-90802241 TTTTGGGGGAGAAGGGGAGACGG + Intronic
993797631 5:92287185-92287207 TTATTTGGAAGAAGTGAACAGGG - Intergenic
993869609 5:93236853-93236875 TTTTGGGGGAAAAGAGAAGAGGG + Intergenic
993951258 5:94178464-94178486 TTAAGGGGAAAAAATGAAGAAGG - Intronic
994108973 5:95979543-95979565 TTATGGGGAAGAGTTGAAAAAGG + Intergenic
994613596 5:102077201-102077223 TTAGAGAGAAGGAGGGAAGAGGG + Intergenic
994672296 5:102777331-102777353 TTATGGGGAAAAAGGAGAGCAGG - Intronic
995213986 5:109573722-109573744 TTCTGGGGAATAAAGCAAGAAGG - Intergenic
996227515 5:121018644-121018666 TTAAAGGGAGGTAGGGAAGAAGG + Intergenic
996812610 5:127534865-127534887 TTAAGGTGAAGAAGGCTAGAGGG - Intronic
996858406 5:128036683-128036705 TTCTGGTGAAGAAAGGAAGATGG - Intergenic
997741627 5:136260011-136260033 GTATGTGGAGGAAAGGAAGAAGG + Intronic
997871162 5:137506174-137506196 ATAGGGGGAAGAAAGCAAGAAGG - Intronic
997924260 5:138013898-138013920 CTATAGGGGATAAGGGAAGATGG - Intronic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
998696038 5:144640942-144640964 TTATGGGGCAGGGGAGAAGAAGG - Intergenic
998788054 5:145733974-145733996 CTATGGGGAAGGACTGAAGATGG + Intronic
999242346 5:150135267-150135289 GAATGGGGAAGAAGGGATGTGGG + Intronic
999445426 5:151634948-151634970 TTATTGTGATGAAGGAAAGAAGG + Intergenic
999550622 5:152683360-152683382 TGGTGTGGAAGAAGGGAACAGGG + Intergenic
999757359 5:154674702-154674724 GAAGGGGGAAGAAAGGAAGAAGG + Intergenic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1000304056 5:159979930-159979952 TGATGAGGAAGAGGAGAAGATGG + Intergenic
1001170595 5:169415723-169415745 TTCTGGGGTAGAGAGGAAGAAGG - Intergenic
1001626955 5:173144322-173144344 ACATGGAGAGGAAGGGAAGAGGG - Intergenic
1001678406 5:173537454-173537476 TGCTGGGGAAGAGGGGAATAGGG - Intergenic
1001877431 5:175213502-175213524 TGATGGTGAAGAAGGAAAGAAGG - Intergenic
1002494776 5:179604245-179604267 GCAAGAGGAAGAAGGGAAGAGGG - Intronic
1003242962 6:4360633-4360655 TGAGGAGGAAGGAGGGAAGAAGG - Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003491487 6:6626400-6626422 TTCTGTGGAAGAAGGAAAGGAGG + Exonic
1004001480 6:11600805-11600827 AGAATGGGAAGAAGGGAAGAAGG - Intergenic
1004219323 6:13731979-13732001 TTGACGGGAAGAGGGGAAGATGG + Intergenic
1004505545 6:16244006-16244028 ATTTGGGTGAGAAGGGAAGAGGG + Intronic
1005001086 6:21242583-21242605 TAAGAGGGAAGAAGAGAAGAGGG - Intergenic
1005225533 6:23638030-23638052 TTCTGGGGGCGAAGGGAATAAGG - Intergenic
1005390702 6:25330403-25330425 TTTTGGGGAGCCAGGGAAGAAGG + Intronic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1006193535 6:32223558-32223580 CCATAGGGAAGAGGGGAAGAGGG - Intronic
1006432855 6:34008472-34008494 TTATGGTCAAGTGGGGAAGAGGG - Intergenic
1006970872 6:38043570-38043592 TGAAGGGGAAGAGGGGAAGGGGG - Intronic
1007422915 6:41730293-41730315 TTATAGGGAAGGAGTGAGGAAGG + Intronic
1007520801 6:42450999-42451021 GGAGAGGGAAGAAGGGAAGAAGG + Intronic
1007816949 6:44531400-44531422 ATATGGGGAAGGAGAGAAGGGGG + Intergenic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008699650 6:54083398-54083420 TGTTGGGGAAGCAGGGAGGAAGG + Intronic
1008911187 6:56735526-56735548 TTATGGGACAGAGGGGCAGAGGG - Intronic
1009035444 6:58112329-58112351 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009211259 6:60865921-60865943 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009530552 6:64808048-64808070 AGAAAGGGAAGAAGGGAAGAAGG - Intronic
1009799480 6:68517409-68517431 TTAAAGGAAAGAAAGGAAGAAGG + Intergenic
1010339231 6:74728490-74728512 TTATTGGGAAAAAGAAAAGACGG + Intergenic
1010639596 6:78308126-78308148 ATATTTGGAAGAAAGGAAGAAGG - Intergenic
1011486963 6:87852836-87852858 TAAAGGGGAAGAAGGGAGGTGGG - Intergenic
1011789187 6:90879638-90879660 TTAGGGGGAAGAGTGGGAGAAGG - Intergenic
1012213255 6:96550664-96550686 TTAAGCAGAAGAAGGGAAGGGGG - Intronic
1012452825 6:99371664-99371686 TTATTTGGAAGAAAGGAGGAGGG - Intronic
1012833272 6:104232336-104232358 TCATGGGGTAGAAGGCAAAATGG + Intergenic
1012934562 6:105352862-105352884 TGATGTGGTAGAATGGAAGAGGG + Intronic
1012943928 6:105446542-105446564 TGATGGGGGAGGAGGGAGGAAGG - Intergenic
1013195239 6:107838867-107838889 TTGGGAGGATGAAGGGAAGAAGG + Intergenic
1013463972 6:110400750-110400772 TTATGGGTAATCAGGGAAGGCGG - Intronic
1014325927 6:119993207-119993229 TTCTAGGGAATAAGGGAAGTGGG + Intergenic
1014507055 6:122272653-122272675 TTATTGGGAAGAAGTGAAGCAGG - Intergenic
1014953382 6:127586318-127586340 TTATGGGGCAAAAAGGAAAAAGG + Intronic
1014984629 6:127988177-127988199 GCATGGGGAAGAGAGGAAGAGGG + Intronic
1015266083 6:131293626-131293648 TCATGGGGAAGAGGGGAGGCTGG + Intergenic
1015429462 6:133113395-133113417 TTACATGGCAGAAGGGAAGAAGG - Intergenic
1015550095 6:134402946-134402968 TCCTGGGAAAGAAGGGAGGAAGG - Intergenic
1015736864 6:136410256-136410278 TGATGGGGAAGAGGGGGAAAAGG + Intronic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016532630 6:145075259-145075281 AGAGAGGGAAGAAGGGAAGAAGG + Intergenic
1016774561 6:147891179-147891201 TCTTGGGGAGGAAGGGAAAAGGG + Intergenic
1017155045 6:151315342-151315364 TCATGTGGCAGAAGGGCAGAGGG + Intronic
1017638844 6:156470748-156470770 TTGTGGGGAAGGAATGAAGAGGG + Intergenic
1017774132 6:157667508-157667530 CAATGGGGAAGAAGGATAGAGGG + Intronic
1018650030 6:165985840-165985862 GTGTGGGGAAGAAGGGAGGGTGG - Intronic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019624747 7:2010292-2010314 TCACGGGGAGGAAGGGAAGACGG + Intronic
1019839425 7:3425173-3425195 TTATGGGGAAGAAAAACAGAAGG - Intronic
1020714927 7:11661015-11661037 CTATGGCCAAGAAGTGAAGAAGG + Intronic
1021222349 7:17988725-17988747 AGATGGGGAAGAAGAAAAGAAGG + Intergenic
1021752730 7:23820116-23820138 TTATGGGGAAAAAGTGTAAAAGG - Intronic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022482795 7:30754715-30754737 ATAGAGGGAAGAAGGAAAGATGG - Intronic
1022644706 7:32219437-32219459 GTATATGGAAGTAGGGAAGAAGG - Intronic
1023008840 7:35906863-35906885 TAAGGGGGAAAAAGGAAAGACGG + Exonic
1024022338 7:45383510-45383532 TTTTGGGGGAGAAGCCAAGATGG - Intergenic
1024171342 7:46791075-46791097 TAAGGGGGAAGAAGGGAAGGGGG + Intergenic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1024883115 7:54111856-54111878 TTACAGGGAAGATGGGAGGAGGG + Intergenic
1025021293 7:55482319-55482341 TTTTGGGGAAGAGAGGAAGAAGG + Intronic
1026327105 7:69320074-69320096 TGCTGGGGAAGAAGGAAAAACGG + Intergenic
1026464308 7:70640863-70640885 ATATGGGCAAGAAGGGATGACGG - Intronic
1026526915 7:71161994-71162016 GAAGGAGGAAGAAGGGAAGAAGG - Intronic
1026552765 7:71381953-71381975 TTGTGGGAAAGAAAGGCAGAGGG + Intronic
1026741786 7:72983474-72983496 TTATGAGGAAGGAGAGAAGAGGG + Intergenic
1026801629 7:73403902-73403924 TTATGAGGAAGGAGAGAAGAGGG + Intergenic
1027101949 7:75381603-75381625 TTATGAGGAAGGAGAGAAGAGGG - Intergenic
1027294571 7:76755637-76755659 TAATGGGGAATAAGAGAATATGG - Intergenic
1027348850 7:77289810-77289832 TTATGGAAGAGAAGGGAAGTTGG + Intronic
1027813654 7:82940539-82940561 TGATTGGAAAGAAAGGAAGAGGG + Intronic
1028132875 7:87197401-87197423 TTATGGTGAAGAAACAAAGATGG - Intronic
1028210951 7:88073664-88073686 TTAGGGGCAAGTAGGGTAGAGGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028480746 7:91301855-91301877 ATATGGGGAGGAAAAGAAGAAGG - Intergenic
1028843494 7:95453655-95453677 TTAAAGGGAAGAAGGGAAGAAGG - Intergenic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1030376064 7:108755056-108755078 TTATGGGGGAGAGGGAAAGATGG + Intergenic
1030407103 7:109128817-109128839 TAATGGGCAAGAAAGAAAGAAGG + Intergenic
1031358834 7:120822381-120822403 TCAAGGGGAAGAAGGGATAAGGG - Intronic
1031714738 7:125094820-125094842 TAATGTGGAAGAAGGTCAGAGGG + Intergenic
1031798440 7:126209666-126209688 TGATGGGGAGGAAGGGGAGGAGG - Intergenic
1031827833 7:126588602-126588624 TTATGGGGGAAAATGGCAGATGG + Intronic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1032496571 7:132367502-132367524 GTATTGGGAAGAAAGGATGAAGG + Intronic
1032698775 7:134360536-134360558 TTGTGGGGAAGCAGGAATGAGGG - Intergenic
1033291984 7:140093352-140093374 TTGTGGGGGAGAAGGGAAGGAGG - Intronic
1033617372 7:143029479-143029501 CCCTTGGGAAGAAGGGAAGAGGG - Intergenic
1033642147 7:143271564-143271586 TTATTGATCAGAAGGGAAGAGGG - Intergenic
1033933431 7:146552610-146552632 TTAGGGGGAGGAAAGAAAGAAGG - Intronic
1034029646 7:147746513-147746535 TGATGGGGTAGAAGGGAGAAAGG - Intronic
1034090369 7:148358334-148358356 ATGGGGGGAAGAAGGCAAGATGG + Intronic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1034252927 7:149706662-149706684 TTAGGGGGAAGAAGAGGAGGGGG - Intergenic
1034737575 7:153443223-153443245 TTACTGGGAAGAAGAGAACAGGG - Intergenic
1036145321 8:6249831-6249853 TTTTGAGGAATCAGGGAAGAAGG - Intergenic
1036385456 8:8275579-8275601 TTATGGTGGAGAAGGTAAAAGGG - Intergenic
1037611998 8:20483695-20483717 TTATTGGGATGAATGGCAGAGGG - Intergenic
1038274459 8:26108858-26108880 TGATGGAGAAGAAGAAAAGAAGG + Intergenic
1038388927 8:27176436-27176458 ATATGGAGAAGAAGAAAAGAAGG - Intergenic
1038706163 8:29896083-29896105 GTATGTGAAACAAGGGAAGATGG - Intergenic
1038962826 8:32540225-32540247 TCTTAGGGAAGAGGGGAAGAAGG + Intronic
1039446641 8:37638427-37638449 GTAGGGGGAGGAATGGAAGAAGG + Intergenic
1039807053 8:41009239-41009261 GTATGGGGAACAAGAGTAGAGGG + Intergenic
1040626899 8:49159757-49159779 TTGTGGGAAAGAGGGAAAGAGGG + Intergenic
1041039569 8:53833760-53833782 TGATTGGGAGGGAGGGAAGATGG - Intronic
1041206239 8:55500659-55500681 TTATGGGGGCAAAGAGAAGACGG + Intronic
1041577131 8:59411213-59411235 TTATGGGGAGCAAGGGAGGATGG + Intergenic
1041779405 8:61561033-61561055 GTAAGGGAAGGAAGGGAAGAAGG + Intronic
1041850450 8:62385496-62385518 ACATGGGGAAGAGGGGAAAAGGG + Intronic
1042007748 8:64201171-64201193 TGATTGGGAAAAATGGAAGAAGG + Intergenic
1043836877 8:85058566-85058588 TTATGGGCTAGAAGAGAATAAGG - Intergenic
1044220245 8:89662245-89662267 TCAAGGATAAGAAGGGAAGAAGG - Intergenic
1044268641 8:90213319-90213341 ATATGTGTTAGAAGGGAAGATGG - Intergenic
1044562148 8:93623072-93623094 TTATTGGAAGGAAGGAAAGAAGG + Intergenic
1044701948 8:94973357-94973379 TCATGGGGGAGAAGGCATGAGGG - Intronic
1044899698 8:96931093-96931115 TTACGGGGAAGAAGGAAGGGTGG - Intronic
1045271466 8:100665431-100665453 ATTTTGGGAAGAAGGGAAAACGG - Intergenic
1045298238 8:100890766-100890788 TGAAGGGGAAGTTGGGAAGAGGG + Intergenic
1045330923 8:101155085-101155107 TCATGGGGGAGAAGGGAGGGAGG - Intergenic
1045484890 8:102623139-102623161 GTTTGGGGGAGAAGGGTAGATGG - Intergenic
1045502050 8:102751161-102751183 TATTATGGAAGAAGGGAAGAAGG - Intergenic
1046852452 8:118990449-118990471 TAATGCTGAAGAAAGGAAGATGG + Intergenic
1047194343 8:122707928-122707950 TCATGGGGCAGAAGGGATGAGGG + Intergenic
1047283177 8:123463720-123463742 TAAGGGGGAAGAAAGGAAGCAGG + Intronic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1047694827 8:127393304-127393326 TGAAAGGGAAGGAGGGAAGAAGG + Intergenic
1047833847 8:128666271-128666293 TTATGAGTAAGAAAGGAAGGAGG + Intergenic
1047933389 8:129751948-129751970 TTCAGGGAAAGAAGGGCAGAAGG - Intronic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048697960 8:137049808-137049830 TAATTGGCAAGAATGGAAGAAGG - Intergenic
1049912960 9:287451-287473 TTCTGGGGAAGATGAGAAGATGG - Intronic
1050696613 9:8286273-8286295 TGTTGGGGAAGGAGGGAATAAGG - Intergenic
1050747837 9:8898040-8898062 TAATAGGGAAGAGTGGAAGAAGG - Intronic
1051014821 9:12461986-12462008 AGAGGGGGAAGAAAGGAAGAAGG - Intergenic
1051707309 9:19894109-19894131 TTTTGAGGAAGAAGGGGAAAAGG + Intergenic
1052022661 9:23542790-23542812 TTATGGGGAAAAATAAAAGAAGG + Intergenic
1052728873 9:32262310-32262332 TTATGGGGGAGAGGGAGAGAGGG - Intergenic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1052769788 9:32677099-32677121 TCATGGAGAAGAGGGGAAAAGGG - Intergenic
1052989413 9:34510377-34510399 TTCTGGGGAAGGAGGCAGGAAGG + Intronic
1053030318 9:34770713-34770735 TTAGGTGGAGAAAGGGAAGAGGG + Intergenic
1053055998 9:34993431-34993453 GTATGGGGAGGAAGGTAAGAGGG + Exonic
1053230670 9:36406153-36406175 TTGGGGGGAAGAATGGATGACGG + Intronic
1054930717 9:70632316-70632338 GTTTGGGGAAGAAGTGAATAAGG - Intronic
1055204883 9:73716813-73716835 TTATAGGGAAAAAGTCAAGAGGG - Intergenic
1055572784 9:77633420-77633442 TCATGGGGAATAATGGCAGAGGG + Intronic
1055868547 9:80845596-80845618 TTATTCGGAAGAAGGGAATGGGG + Intergenic
1056486244 9:87060877-87060899 TCATGGGGAAGGAGGAAAGTTGG - Intergenic
1056628841 9:88276050-88276072 ATGTGGGGCAGAGGGGAAGAGGG - Intergenic
1056698537 9:88881331-88881353 TTGTGGGGAAGAGTGGGAGAGGG - Intergenic
1057905131 9:98977311-98977333 TGCTGGGCAAGAAGGGAGGAGGG - Intronic
1057907498 9:98993966-98993988 AAATGGGGAAGAAGGCAAGGAGG - Intronic
1058156182 9:101518426-101518448 TTGGGGGGAAGAATGGAAGGAGG - Intronic
1058174262 9:101719938-101719960 TGAGGAGGAAGAAGGGAAGTTGG - Intronic
1059021757 9:110583255-110583277 ATATGGGGAAAGATGGAAGAGGG + Intergenic
1059400121 9:114063950-114063972 TTATAGGGAAAAAGGGAATCAGG + Intronic
1060209329 9:121700213-121700235 TGGTGGGGCAGAAGGGGAGAGGG + Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1060926005 9:127455607-127455629 TTCTGCAGAAGAAGGTAAGATGG + Exonic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1062179912 9:135185768-135185790 TTAGGGGGAAGCCGGTAAGAGGG - Intergenic
1185529736 X:807853-807875 TTATTTGTAAGAAAGGAAGAAGG - Intergenic
1185914994 X:4025652-4025674 ATAAAGGGAAGAAGGGAAGGAGG - Intergenic
1186530331 X:10288787-10288809 TTCTCAGGCAGAAGGGAAGAGGG + Intergenic
1186558043 X:10581551-10581573 TTCAGGACAAGAAGGGAAGAAGG - Intronic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1187251683 X:17604568-17604590 TTAAGAGGAAGAAGGGGAGAAGG + Intronic
1187541457 X:20200180-20200202 TTATTGGGAAGATGTGAAAAGGG + Intronic
1187701343 X:21967166-21967188 ACAAGGGGAAGAAGGCAAGATGG - Intronic
1187842881 X:23506884-23506906 TTATTGGGCAAAAAGGAAGAAGG - Intergenic
1188162917 X:26824048-26824070 TTATGAGAAACAAGGGAATATGG + Intergenic
1188278422 X:28231742-28231764 CTATGGTGAAGAAGGGAAATTGG - Intergenic
1188550402 X:31358112-31358134 TGAGGGGGAATGAGGGAAGAGGG - Intronic
1189150746 X:38703798-38703820 CTTTGGGGAAGAAGAAAAGAAGG + Intergenic
1189180448 X:38999596-38999618 GTTTGTGGAAGTAGGGAAGAGGG - Intergenic
1189696300 X:43666847-43666869 ATATGGGGAAGATAGGAAAAAGG - Intronic
1189778040 X:44487804-44487826 GAAAGGGGAAGAAGGGAAGGAGG + Intergenic
1190574472 X:51819175-51819197 ATGTGGGGCAGAGGGGAAGAAGG - Intronic
1190774690 X:53543385-53543407 TTATGGAGAATAAAGGCAGAGGG + Intronic
1191705019 X:64085393-64085415 CTATGGGGAAGCTGGAAAGATGG + Intergenic
1192428470 X:71096992-71097014 GTGTTGGGAAGAAGGTAAGAGGG - Intronic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193011554 X:76681092-76681114 GTACGTGGAAGAAGGGAGGAAGG + Intergenic
1193674123 X:84426648-84426670 ATATGGGGGAAATGGGAAGATGG + Intronic
1194363645 X:92986581-92986603 TTATGAGGAATGATGGAAGATGG + Intergenic
1194371928 X:93084182-93084204 TTCTGGGAAAGAAGGGATCAAGG - Intergenic
1194839850 X:98726705-98726727 TTAAGTGGAAGAACGGAGGAAGG + Intergenic
1195423795 X:104704983-104705005 CTATTGGGAAGATGGGAAGGTGG + Intronic
1195578799 X:106478884-106478906 ATATGGGGTGGAGGGGAAGAAGG + Intergenic
1195892735 X:109713065-109713087 ATGAAGGGAAGAAGGGAAGAAGG + Intronic
1196038288 X:111171699-111171721 TTTTGGGAACTAAGGGAAGATGG + Intronic
1196161236 X:112485200-112485222 TTAGGGGGAAGAGTGGAAGGGGG - Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1197622594 X:128767505-128767527 TAATGGGGAAGAAGGTAACTGGG - Intergenic
1198015872 X:132610366-132610388 ATATAGGAATGAAGGGAAGAAGG + Intergenic
1198219409 X:134585954-134585976 TTGAGGGGAAGAAGGGCACATGG - Intronic
1198303216 X:135351356-135351378 TGATGGAGAAGAAGGGAGTAAGG + Intronic
1198388540 X:136150337-136150359 GCATGGGGAAGAAGGGAACTAGG - Intronic
1198405313 X:136306231-136306253 TTAAGGGAAAGAAGGAGAGAGGG - Intronic
1198482802 X:137056295-137056317 ATATGGGGAAAAAGGGAAAGGGG + Intergenic
1198546260 X:137695740-137695762 TTATAGAGAAGGAGGGCAGAGGG - Intergenic
1199035048 X:143040202-143040224 TGATGAGGGAGAAGGGAATAAGG - Intergenic
1199298491 X:146186125-146186147 TGATGGACAAGAAGGGAAAAAGG + Intergenic
1199834881 X:151579678-151579700 TTATTGGGAGAAAGTGAAGATGG + Intronic
1200671879 Y:6102837-6102859 TTATGAGGAATGATGGAAGACGG + Intergenic
1200679969 Y:6198215-6198237 TTCTGGGAAAGAAGGGATCAAGG - Intergenic
1201531583 Y:14995212-14995234 TAATGAGGAAGAAGGGCAAAAGG + Intergenic
1202012855 Y:20366969-20366991 TAATGAGGAAGAATGGAATAAGG + Intergenic