ID: 1008147849

View in Genome Browser
Species Human (GRCh38)
Location 6:47913119-47913141
Sequence TGACACAACCAATATGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008147849 Original CRISPR TGACACAACCAATATGGGGT AGG (reversed) Intronic
900165199 1:1241725-1241747 TGCCAGAGCCAAAATGGGGTGGG + Intergenic
902128688 1:14239833-14239855 TGCCACAACCAACAATGGGTGGG + Intergenic
903375404 1:22862771-22862793 TGACACAGCCAAGCTGGGATAGG + Intronic
905136948 1:35807743-35807765 TGACAGAAGCGATCTGGGGTGGG + Intergenic
907713277 1:56904228-56904250 TGACACTAACAAGTTGGGGTCGG - Intronic
909521478 1:76573532-76573554 TAACACAAACAATGTGAGGTAGG - Intronic
909789788 1:79661288-79661310 TGACACAAGAAAAATGGGGCAGG - Intergenic
910069625 1:83196096-83196118 TCACACAACCAGTATGGAATTGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912702660 1:111889745-111889767 TAACACAGACAAAATGGGGTAGG + Intronic
916029932 1:160867149-160867171 TGACACTAGCAATGTGGTGTGGG + Intergenic
920271447 1:204767801-204767823 TCACACAATCAATAAGTGGTGGG - Intergenic
923249258 1:232164809-232164831 TCACACAGCTAATATGTGGTAGG + Intergenic
924121519 1:240804320-240804342 TTACAAAACCCCTATGGGGTTGG + Intronic
924630588 1:245736470-245736492 TGGCAGAAACAATATGGGGATGG + Intergenic
1063323550 10:5074866-5074888 TAACACAGACAAAATGGGGTAGG - Intronic
1067714454 10:48678677-48678699 TAACTCTACCAATATGGAGTTGG + Intergenic
1068209215 10:53898261-53898283 AGAAACAACCCATATGGGGCCGG - Intronic
1073928975 10:108552044-108552066 TGATAAAACCAATATAGGCTAGG - Intergenic
1074429323 10:113380134-113380156 TCACACCACCCATGTGGGGTAGG - Intergenic
1077664097 11:4092871-4092893 GGACACAACCAGTTTGGGGAAGG + Exonic
1080679737 11:34463109-34463131 TGAGCAAACCAATCTGGGGTTGG - Intronic
1081809341 11:45906404-45906426 TGACAGGACCAAGATGGGGCTGG - Exonic
1084707971 11:70826690-70826712 TGACAGACAGAATATGGGGTGGG - Intronic
1087195831 11:95303418-95303440 GGTGACAACCAATATGTGGTGGG + Intergenic
1089665912 11:120018965-120018987 TGACACAATCAAAACGGTGTTGG - Intergenic
1089715435 11:120354262-120354284 TCACCCAACCACTCTGGGGTAGG - Intronic
1102166266 12:110809234-110809256 GGACACATCCAATGTGGGGAGGG + Intergenic
1103363485 12:120367666-120367688 TGACTCACCCAATTTGGGCTGGG + Intronic
1104537405 12:129631050-129631072 TGACCTACCCCATATGGGGTAGG + Intronic
1106993916 13:35458255-35458277 TGATACAATCAAAATGTGGTGGG - Intronic
1107380861 13:39855347-39855369 AGACAGAACTAATCTGGGGTTGG - Intergenic
1108259499 13:48642639-48642661 TAACACAGACAAAATGGGGTAGG - Intergenic
1109907061 13:68856943-68856965 TTACACTTCCAATATGGGGCAGG + Intergenic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1112823910 13:103369674-103369696 TGACAAAACCAATATGGGGATGG - Intergenic
1113169089 13:107478525-107478547 TTACAAAAACACTATGGGGTTGG + Intronic
1114812306 14:25915488-25915510 TGACACAATCAGAATGTGGTAGG - Intergenic
1115860986 14:37686228-37686250 TCACAAAAACAATATGAGGTGGG - Intronic
1116262934 14:42654213-42654235 TAACACAGACAAAATGGGGTAGG - Intergenic
1117186496 14:53245463-53245485 TGACACAGACAAAATGGGATAGG - Intergenic
1117827581 14:59719555-59719577 TGATTCAACCAATATGGCATAGG - Intronic
1119649871 14:76376023-76376045 TGACAGAATCAAGCTGGGGTGGG - Intronic
1120374758 14:83689389-83689411 TGACATAAAAAATGTGGGGTAGG + Intergenic
1202871789 14_GL000225v1_random:171822-171844 AGACAAGAGCAATATGGGGTGGG - Intergenic
1130644219 15:85709495-85709517 TGACAGAAGCAAGCTGGGGTGGG - Intronic
1135062937 16:19286347-19286369 TGTCACAGCCAAGGTGGGGTTGG - Intronic
1135477594 16:22790453-22790475 TAACATAACCATTATGGGTTGGG + Intergenic
1141397888 16:83720867-83720889 TGGCACAACCTTTATGGAGTGGG + Intronic
1142503736 17:349506-349528 TGAAATAATCAATATGTGGTGGG - Intronic
1145942217 17:28748547-28748569 TGCCCCAACCAATGTGGTGTGGG + Exonic
1148944868 17:51252328-51252350 TGACAGAACCAGTATTGGGGAGG - Intronic
1153812034 18:8760338-8760360 TAATACCACCAATATGAGGTGGG - Intronic
1159475195 18:68911962-68911984 TTACAAAACCAAAATGGGATTGG - Intronic
1161470855 19:4456221-4456243 TGATTCAACCAATAGTGGGTGGG - Intronic
1167659808 19:50790039-50790061 TGAGACGAACAATGTGGGGTGGG + Intergenic
926717878 2:15939398-15939420 TGACACAACTATTATGGGCTGGG + Intergenic
927142409 2:20139543-20139565 TGTCACATCCTATCTGGGGTGGG - Intergenic
927352142 2:22128139-22128161 TAACACAGACAAAATGGGGTAGG - Intergenic
927780513 2:25935692-25935714 AGAAACAACCAAAATGGGGTTGG + Intronic
932060038 2:68487405-68487427 TTACACAACCAATAAGTAGTAGG - Intronic
940836775 2:158530683-158530705 TGCCACAACCAACATGGGGCAGG - Intronic
1172138486 20:32704730-32704752 TGACACAGCCACTATGGGGAAGG - Intronic
1174293482 20:49526148-49526170 TGACATGATCAATCTGGGGTTGG - Intronic
1174980783 20:55392237-55392259 GAACTCAACCAACATGGGGTTGG + Intergenic
1175225972 20:57444223-57444245 TAACACAGACAAAATGGGGTAGG - Intergenic
1175226402 20:57446724-57446746 TAACACAGACAAAATGGGGTAGG + Intergenic
1177879949 21:26681076-26681098 TGACAAAAACAACATGGAGTTGG - Intergenic
1183419296 22:37701353-37701375 TGACTCACCCAATATGGAGGAGG + Exonic
952012337 3:28914371-28914393 TGAGAAAAACAATATAGGGTAGG - Intergenic
954042056 3:47895989-47896011 TGAAAGAAGCAATCTGGGGTGGG + Intronic
954195555 3:48994731-48994753 TGACAGAATCAGTGTGGGGTGGG - Intronic
961115639 3:124327024-124327046 TGACATCACCAACATGGAGTTGG - Intronic
964612674 3:158630774-158630796 TAACACAGCCAAAATGGGGTAGG - Intergenic
965330158 3:167362841-167362863 TGACACAAGCAATAAGTGGATGG - Intronic
968824470 4:2883964-2883986 AGAAACAACCAATATGGGCTGGG - Intronic
973246959 4:48019304-48019326 AGTCAAAACCAATGTGGGGTGGG - Intronic
975228516 4:71903431-71903453 TGACACAATCAGCTTGGGGTGGG + Intergenic
977039695 4:92001366-92001388 TTACACAGCCAATAAGTGGTAGG + Intergenic
982244253 4:153334178-153334200 GGTCACAACAAATATTGGGTGGG - Intronic
989325864 5:40193627-40193649 TTACACAACTAATATGAGTTGGG - Intergenic
991025150 5:62021080-62021102 AGACACAATCAGTATGTGGTAGG + Intergenic
991948391 5:71923986-71924008 TTGCACAACCAATATGCAGTAGG + Intergenic
999997695 5:157107799-157107821 TAACACAGACAAAATGGGGTAGG - Intronic
1000303648 5:159976764-159976786 TGACAAAACCAAAATGGGTAAGG + Intergenic
1000678176 5:164149080-164149102 TGCCACAACCAATATAAGGCAGG - Intergenic
1001283616 5:170406382-170406404 TTACACGACCAATAATGGGTAGG - Intronic
1008147849 6:47913119-47913141 TGACACAACCAATATGGGGTAGG - Intronic
1010285658 6:74074627-74074649 AGACAGCACCAATAAGGGGTGGG - Intergenic
1010636397 6:78263976-78263998 TTACACAAATAAAATGGGGTAGG - Intergenic
1011295670 6:85824905-85824927 TGAGACAACCAATATGGGGAAGG - Intergenic
1013459280 6:110359205-110359227 TCCCACAACCCATTTGGGGTGGG + Intergenic
1014950313 6:127546863-127546885 TGACAAAACCGATCTGGGTTAGG - Intronic
1019019757 6:168908390-168908412 TCACACAGCCAACATGAGGTTGG + Intergenic
1023253249 7:38287613-38287635 TCACACAGCTAATATGGGGAGGG + Intergenic
1026005471 7:66597107-66597129 TGACCCACACAATAAGGGGTGGG - Intergenic
1027287406 7:76661271-76661293 TCACACAACCAGTATGGAATTGG - Intergenic
1030267992 7:107640303-107640325 TGACAAAACCAATAGGGTCTTGG - Intergenic
1036494716 8:9259786-9259808 TGACACATCCAATGTGGAGATGG + Intergenic
1042019126 8:64351357-64351379 TCACACAACCAACAAGTGGTAGG + Intergenic
1048128043 8:131659253-131659275 TCACAGCACCAATGTGGGGTAGG + Intergenic
1050472868 9:6010342-6010364 TTACACAAGAAATATGGGCTGGG + Intergenic
1055349262 9:75369021-75369043 TGAGAAAACAAATATGGGGTAGG + Intergenic
1060261756 9:122081426-122081448 TGACAGAACTAATATGTGGTGGG + Intronic
1186270312 X:7879459-7879481 TAACACCACAAATATGGGTTTGG - Intergenic
1186567464 X:10678942-10678964 TACCACCACCAATCTGGGGTTGG + Intronic
1186613512 X:11162337-11162359 TGACACAGTAAATATGGGGGGGG - Intronic
1186714177 X:12232624-12232646 TGGCAAAACCAGTATTGGGTGGG + Intronic
1187339760 X:18410711-18410733 TGACAGAAGCCTTATGGGGTAGG - Intergenic
1190904007 X:54708194-54708216 TTACAAAACCACAATGGGGTTGG + Intergenic
1191961728 X:66710837-66710859 AGAGAGAACCAAAATGGGGTTGG + Intergenic
1198739508 X:139826036-139826058 TGACACAACTAGTAAGTGGTTGG + Intronic
1201925740 Y:19285688-19285710 TGACACAGACAAAATGGGGTAGG + Intergenic
1201927201 Y:19300205-19300227 TAACACAAACAAAATGGGGTAGG + Intergenic