ID: 1008148968

View in Genome Browser
Species Human (GRCh38)
Location 6:47927057-47927079
Sequence CAGTCCCATGAGAAGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008148968_1008148978 23 Left 1008148968 6:47927057-47927079 CCACTCAACTTCTCATGGGACTG 0: 1
1: 0
2: 4
3: 14
4: 158
Right 1008148978 6:47927103-47927125 ATTGGAAGCCATCATTTCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 169
1008148968_1008148972 -1 Left 1008148968 6:47927057-47927079 CCACTCAACTTCTCATGGGACTG 0: 1
1: 0
2: 4
3: 14
4: 158
Right 1008148972 6:47927079-47927101 GGGGATCCCCCAAGTTCTCTAGG 0: 1
1: 0
2: 1
3: 6
4: 112
1008148968_1008148974 5 Left 1008148968 6:47927057-47927079 CCACTCAACTTCTCATGGGACTG 0: 1
1: 0
2: 4
3: 14
4: 158
Right 1008148974 6:47927085-47927107 CCCCCAAGTTCTCTAGGCATTGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008148968 Original CRISPR CAGTCCCATGAGAAGTTGAG TGG (reversed) Intronic
900231132 1:1558686-1558708 CAGCCACATGAGAAGGTGTGTGG - Intronic
900506652 1:3032694-3032716 CAGCCCCAAGAGGAGGTGAGGGG + Intergenic
901427430 1:9191333-9191355 CAGCCACATGAGAAGTTGGGGGG - Intergenic
902819904 1:18937512-18937534 CAGCCCCATGGGTAGTTGGGAGG - Intronic
904385664 1:30140535-30140557 CAGTCCCAAGAGAACATGGGAGG - Intergenic
905830967 1:41067075-41067097 CATTCCCATAAGTAGGTGAGTGG + Intronic
912203525 1:107484648-107484670 CAGGTCCAAGAGAAGGTGAGGGG - Intergenic
912304865 1:108557103-108557125 CAGTCTGGTGAGAAGTTGAAAGG - Intergenic
915016887 1:152742753-152742775 CAGTGCTATGAGAAGCTGTGGGG - Intronic
916462897 1:165045434-165045456 GAGACCCAAGAGAAGGTGAGTGG + Intergenic
916698103 1:167261609-167261631 AAGTGCCATGGGAAATTGAGTGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
922469615 1:225867893-225867915 AAGTCCCCTGAGAGGTTGACAGG + Exonic
924603269 1:245510022-245510044 CAGTGCCATGAACAGTGGAGTGG + Intronic
924615997 1:245612545-245612567 CATTGCCATGAGAATGTGAGAGG + Intronic
924661338 1:246020854-246020876 CAGTCACGTTAAAAGTTGAGAGG - Intronic
1063453544 10:6167275-6167297 CAGTCCTCTGAGAAGTCGGGAGG + Intronic
1064500350 10:15964961-15964983 CAGTTCCATTAGAAATTGAATGG - Intergenic
1064582733 10:16810552-16810574 AATTCCCAGGAGAAGTTGGGCGG - Intronic
1067153154 10:43753051-43753073 CAGTCCCTGGGGTAGTTGAGTGG - Intergenic
1067320771 10:45218696-45218718 AATTCCCAGGAGAAGTTGGGTGG - Intergenic
1068722677 10:60263650-60263672 CCTTCACATGAGAAGTTGGGGGG - Intronic
1071223523 10:83498232-83498254 CAGTGCCATGAGAAGTAGAGGGG + Intergenic
1072205102 10:93196720-93196742 CAGGACCATGAGAAATGGAGAGG - Intergenic
1075339950 10:121638847-121638869 CAGTTCCATGAAAAGTTCAGGGG - Intergenic
1075596373 10:123732582-123732604 CAGTCCCATGGGAAGTTCTGGGG + Intronic
1079717304 11:23764543-23764565 CAGGTCCAGGAGAAATTGAGAGG - Intergenic
1080614700 11:33935793-33935815 CAGACCCATGGCAACTTGAGAGG + Intergenic
1081398039 11:42610641-42610663 TAATCCCCTGAGAACTTGAGGGG - Intergenic
1081465796 11:43315670-43315692 CAGTTACATGAGAAGATGATAGG - Intronic
1082223169 11:49667174-49667196 CTGTCACCTGAGAAGTTGATTGG + Intergenic
1084744892 11:71163539-71163561 CAGTCCCAGGAGAATGTGATAGG + Intronic
1085230471 11:74964382-74964404 CAGTCCCAACACGAGTTGAGTGG - Intronic
1086783121 11:90931443-90931465 CCTTCCCATGAGGAGTTGAGAGG + Intergenic
1090505629 11:127310549-127310571 CTGGCCCATGGGAAGTTGTGAGG - Intergenic
1091897219 12:4115328-4115350 CAGTCCCATGTGAGGGTGATGGG - Intergenic
1097364866 12:58701303-58701325 CAGTCACTTAAGAAGCTGAGGGG + Intronic
1101630623 12:106490384-106490406 CTTTCCCATGAGCAGTTGAATGG - Intronic
1101902050 12:108798143-108798165 CCCTCCCATGAGGGGTTGAGTGG + Intronic
1102506703 12:113388603-113388625 CAGTCCCATGAAACCTTGACAGG - Exonic
1102604326 12:114057110-114057132 CAGTCTGGTGAGAAGGTGAGAGG - Intergenic
1110524130 13:76516046-76516068 GAGTCCCATTTGAAGCTGAGTGG - Intergenic
1110950373 13:81480880-81480902 TAGCCCCATCATAAGTTGAGTGG - Intergenic
1111270135 13:85870910-85870932 TAGTCTCTTGAGAAGATGAGGGG + Intergenic
1112411379 13:99166488-99166510 CAGTCACATCAGAAGATGATTGG + Intergenic
1112436514 13:99394614-99394636 CAGTCCCAGGGAGAGTTGAGGGG - Intergenic
1119432082 14:74575086-74575108 AAGTCCCAGGAGAGGTTGTGAGG - Intronic
1121089619 14:91171972-91171994 CAGTCCCTAGAGAAATTCAGAGG + Intronic
1121432131 14:93895109-93895131 CAGCCCCATGAGGAGGGGAGGGG - Intergenic
1124712647 15:32028857-32028879 CAGTCCCATGACCAGTGCAGGGG + Intergenic
1125087999 15:35753758-35753780 CAGTACCATGAGAAGCAGAGAGG - Intergenic
1125718674 15:41834787-41834809 CAGTCCCGGTAGAAGTGGAGCGG - Exonic
1127981360 15:64037657-64037679 CTGTCCCTTCAGAAGCTGAGTGG + Intronic
1131094415 15:89646718-89646740 CAGTCCCATGAAAGCATGAGTGG + Intronic
1134314216 16:13103430-13103452 ATGTCCCATGAGCAGGTGAGTGG + Intronic
1136240180 16:28938681-28938703 CAGTCCTATGAGGATATGAGAGG + Exonic
1138273931 16:55717318-55717340 CAGTCCTACGGGAATTTGAGGGG + Intergenic
1139057456 16:63202693-63202715 AAGTCCCATGACCAGCTGAGAGG + Intergenic
1141579101 16:84985079-84985101 CAGTCCCACAAGAAGATGAGTGG - Intronic
1142299890 16:89250567-89250589 CATTCCCATGAGCAGTACAGGGG + Intergenic
1144113806 17:12066062-12066084 GAGTCCCCTAAAAAGTTGAGGGG + Intronic
1144692484 17:17277243-17277265 CAGTCCCATGCGAGGCAGAGAGG - Intronic
1146690488 17:34871669-34871691 CACTACAAAGAGAAGTTGAGGGG + Intergenic
1148770052 17:50061326-50061348 CAGTACCTTGGGAAGTTCAGAGG + Intronic
1149405310 17:56343676-56343698 GAGTCCCAGGAGAAGAAGAGAGG - Intronic
1154069053 18:11136419-11136441 CAGTCACAAGAGAAGATGAAAGG - Intronic
1155844534 18:30689109-30689131 CCATGCCATGAGAAGTGGAGAGG - Intergenic
1157536074 18:48458378-48458400 CAGTCTCAAGCGAAGTTGACGGG - Intergenic
1157755030 18:50210150-50210172 AAGACCCCTGAGAAGGTGAGAGG - Intergenic
1158369279 18:56780381-56780403 CAATCCCATTTGGAGTTGAGAGG - Intronic
1158416145 18:57251314-57251336 CAGTCCCATGAGGAGCTCTGAGG - Intergenic
1159915610 18:74184997-74185019 CAGGCCCATGAGAACCTGGGTGG + Intergenic
1166198947 19:41223772-41223794 AGGTCCCATGAGAAGGGGAGGGG + Intronic
1166257074 19:41614454-41614476 CAGTCCCATCAGAAGTATATGGG + Intronic
926301427 2:11606295-11606317 CATTCCCATCAGAATTTCAGTGG + Intronic
927419692 2:22917262-22917284 GACTCCCATGAGAGGTAGAGGGG + Intergenic
927419888 2:22919555-22919577 CAGTCCCATAAGAAGCAGACAGG + Intergenic
928338827 2:30423730-30423752 AAATGCCATGACAAGTTGAGAGG + Intergenic
930965409 2:57317860-57317882 CAGACCAATGAGATTTTGAGCGG - Intergenic
934992807 2:98933277-98933299 TAGTCCCATCAGAGCTTGAGGGG - Intronic
937604559 2:123782411-123782433 CATTCCCCTGAGTACTTGAGAGG - Intergenic
944773180 2:202934261-202934283 CAGTTCCATGTGAATTTGAGAGG + Intronic
946386120 2:219385574-219385596 GAGTCCCCTGAGAAGTGGGGAGG - Intronic
947718589 2:232354082-232354104 CAGTCCCATGGGGAGCTGAGTGG + Intergenic
1173648040 20:44645920-44645942 CAGGCCCCTGAGCAGTTGTGGGG - Intronic
1175985318 20:62761530-62761552 CAGTCCCAGGAGAAGCTGGCCGG + Exonic
1179147561 21:38781776-38781798 CACTCCCATAAGAGGTGGAGTGG + Intergenic
1179448170 21:41448160-41448182 TAGCCCCATCAGAAGTTCAGAGG - Intronic
1180783110 22:18532500-18532522 AAATCCCATTAGAAGTTGATTGG + Intergenic
1181240008 22:21471857-21471879 AAATCCCATTAGAAGTTGATTGG + Intergenic
1181282812 22:21731849-21731871 GAGTCACATGAGATGTTAAGGGG + Intronic
1181646586 22:24234489-24234511 GAGTCCCAAGAGAAGTTTTGGGG - Intronic
1183504870 22:38203183-38203205 CAGTCCCATGAGAACAGGAAGGG + Intronic
1184379319 22:44135141-44135163 CAGTCCCTTGAGGGGTTCAGTGG + Intronic
1184578407 22:45394071-45394093 CAGTACTTTGAGAGGTTGAGTGG + Intronic
1184741318 22:46430502-46430524 CAGGGCCATGACCAGTTGAGAGG - Intronic
951342670 3:21508274-21508296 CTGTCCTTTCAGAAGTTGAGTGG - Intronic
952843876 3:37670388-37670410 CTGTCCTATGGGAAGGTGAGTGG - Intronic
954956029 3:54518933-54518955 ATGTCCCTTGAGAAATTGAGGGG + Intronic
955351771 3:58198860-58198882 CAGTCCCTTGAGGAGGTGGGAGG + Intronic
955571185 3:60308531-60308553 CAGTCCAAAGAGCATTTGAGAGG - Intronic
955775340 3:62426761-62426783 AAGTCCCTTGAAAAGTTGACAGG + Intronic
961719237 3:128881381-128881403 CAGTCGGATGAGAAGTTCACAGG + Intronic
964338783 3:155686209-155686231 AAGTCCCATGTGTGGTTGAGGGG + Intronic
964913603 3:161812288-161812310 CTGGCCCATGAGAAATTGACTGG - Intergenic
967595488 3:191323060-191323082 CAGTCTTAGGAGAAGTTGATGGG + Intronic
968506826 4:974580-974602 CAGGCCCCTGAGATGGTGAGGGG + Intronic
970423919 4:15929372-15929394 CAGTCCCATCAGAATTGTAGGGG - Intergenic
971447483 4:26766372-26766394 CAGCCCTAAGACAAGTTGAGTGG + Intergenic
974190891 4:58501520-58501542 GAGTCCCAGGAGGAGATGAGAGG + Intergenic
975259234 4:72276673-72276695 CAGCCCCTTGAGAAGTTTGGTGG + Intergenic
976623334 4:87151607-87151629 CAGGCTCATGAGAATTTCAGGGG + Intergenic
976842461 4:89447160-89447182 CAGCTCCATGAAAAGTTTAGAGG + Intergenic
976970281 4:91094795-91094817 CAGTCCCCTGAGAAGAAGAATGG - Intronic
979588449 4:122449023-122449045 CAGTCCTATGAGGAGTTAAGAGG - Intergenic
981186883 4:141814693-141814715 CAATCACATGAGAAGTTTATTGG + Intergenic
981543418 4:145870249-145870271 GAGTTTCATGAGAAGTTCAGAGG + Exonic
981838382 4:149081688-149081710 CAGTCCAATGAGAAATTGGAAGG - Intergenic
986589907 5:9357768-9357790 AAGCCCCATGTGAAGATGAGGGG + Intronic
989606183 5:43246408-43246430 GAGGCCCTTGAGAAGTGGAGTGG + Intronic
989699737 5:44248762-44248784 CATTCACATGAGAATTTTAGAGG - Intergenic
991629775 5:68644942-68644964 CAATCCCATGAGAAAATGACAGG + Intergenic
992270470 5:75057575-75057597 CAGAACACTGAGAAGTTGAGGGG + Intergenic
997238433 5:132289365-132289387 CATTCCCATGGGAAGTCCAGAGG + Intronic
998082140 5:139285047-139285069 CAGTCACACGAGAACTTGTGTGG + Intronic
999997089 5:157102555-157102577 CAGGCCCTTGAGAAGCTCAGAGG + Intronic
1002408281 5:179053474-179053496 CAGTCCCACGAGAAGAAGAATGG + Intergenic
1003562213 6:7190609-7190631 CAGTCCCAGGAAGAGATGAGGGG - Intronic
1004240534 6:13917302-13917324 CAGTCTTGTGAGAAGCTGAGAGG + Intergenic
1004302306 6:14469670-14469692 CTGTCCCAGGAGATGATGAGAGG + Intergenic
1005256690 6:24011005-24011027 CAGTCCCATGAGGAGTAGACAGG + Intergenic
1006594881 6:35185682-35185704 CAGGCCCAGGACAAGCTGAGTGG + Intergenic
1007162528 6:39803501-39803523 CAATCCCATGAGATGGGGAGTGG + Intronic
1007279734 6:40702475-40702497 TAGTCCCATGAGATGTTAACAGG - Intergenic
1007762181 6:44139582-44139604 AGGTCCCCTGAGAAGTTGACAGG - Exonic
1008148968 6:47927057-47927079 CAGTCCCATGAGAAGTTGAGTGG - Intronic
1010341990 6:74764661-74764683 CAGTCAGATGAGATGGTGAGTGG - Intergenic
1010671524 6:78692294-78692316 GAGGGCAATGAGAAGTTGAGGGG + Intergenic
1011631791 6:89333866-89333888 CAGTCCATAGAGAAGTGGAGAGG + Intronic
1011637619 6:89388829-89388851 CAGTCCCATGTGGGGTTGATGGG + Intronic
1018220479 6:161573119-161573141 GAGTCACAGGAGAAGTTGTGGGG + Intronic
1021326708 7:19279741-19279763 CAGTCCCATGAGATAAAGAGAGG - Intergenic
1021440023 7:20667483-20667505 CAGTCTAAGGAGAATTTGAGAGG - Intronic
1023339645 7:39206000-39206022 AAGTCCCATGTCTAGTTGAGAGG - Intronic
1024686500 7:51751516-51751538 CAGGCCCACTAGAAGGTGAGGGG - Intergenic
1025810018 7:64869758-64869780 CAGTCTGGTGAGATGTTGAGGGG - Intergenic
1026517251 7:71083920-71083942 CAGTGCCATGAAAAGTTAAGAGG - Intergenic
1027515514 7:79137389-79137411 GACTACCATGAGATGTTGAGGGG + Intronic
1030136499 7:106256812-106256834 CAACCCCATGCTAAGTTGAGAGG + Intronic
1030158840 7:106486255-106486277 CAGTCACATGAGAAATCGATTGG + Intergenic
1032234101 7:130104737-130104759 CAGGACCAAGAGGAGTTGAGGGG + Intronic
1033674267 7:143522270-143522292 CAGTCCCAGGAAAAGTTGAGAGG - Intergenic
1033687043 7:143650446-143650468 CAGTCCCAGGAAAAGTTGAGAGG - Intronic
1033697568 7:143807177-143807199 CAGTCCCAGGAAAAGTTGAGAGG + Intergenic
1034000831 7:147410987-147411009 GAGTCCTATCAGAAGTTGCGAGG - Intronic
1038770823 8:30477917-30477939 TATTCCCATTAGAATTTGAGGGG + Intronic
1039060499 8:33568265-33568287 TAGCCGCATGAGAATTTGAGGGG - Intergenic
1041245274 8:55882917-55882939 CAGCCTCATCATAAGTTGAGAGG - Intronic
1042134987 8:65624248-65624270 CAGTACCTTGGGAAGCTGAGGGG + Intronic
1043509374 8:80934258-80934280 CAGTCACAGGAGAAGGTGATAGG - Intergenic
1043920255 8:85974545-85974567 CAGTCCCATGGGAATTTCAAAGG + Intergenic
1047796445 8:128260859-128260881 CTGTTCCATGACAAGTTGAGAGG + Intergenic
1048094291 8:131274587-131274609 CAGGCACTTGAGAAGTTCAGTGG + Intergenic
1049637033 8:143694665-143694687 CAGTCCCCCGAGAAGTTTACTGG + Exonic
1052692873 9:31837266-31837288 GAGTCCTGTTAGAAGTTGAGGGG - Intergenic
1185467294 X:362522-362544 CTGTCCCCTGAGTAGTTGATGGG - Intronic
1186067784 X:5784954-5784976 CAGGCCCATGAAAAGGTGAGAGG + Intergenic
1187738693 X:22331195-22331217 CAGGTCCTTGAGAAGGTGAGAGG + Intergenic
1189483891 X:41414326-41414348 CAGTCCTATGAGAATCTAAGCGG - Intergenic
1193591502 X:83393452-83393474 CAGTCATATGGGAGGTTGAGGGG - Intergenic
1195028181 X:100899399-100899421 CAGCCTCTTGAGAGGTTGAGGGG + Intergenic
1199464398 X:148119698-148119720 ATGTCCCATGTGCAGTTGAGAGG - Intergenic
1199800451 X:151246316-151246338 CAGTTCTATGAGAAGAAGAGGGG - Intergenic
1200224543 X:154409871-154409893 CCATCCCATGAGAAGCTGAGTGG - Intronic
1201038290 Y:9804714-9804736 TAGTCTGGTGAGAAGTTGAGGGG - Intergenic
1201526448 Y:14940563-14940585 CAGGCCCATGAAAAGGTGAAAGG - Intergenic
1201680772 Y:16641839-16641861 CAGTCCCCTGAGAAGAAGAATGG - Intergenic