ID: 1008154034

View in Genome Browser
Species Human (GRCh38)
Location 6:47991047-47991069
Sequence TGTTTGATTGGAGGACAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 1, 2: 2, 3: 53, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008154034 Original CRISPR TGTTTGATTGGAGGACAAGA GGG Intronic
902101966 1:13997737-13997759 TGATTGATTGGAGTACTTGAAGG + Intergenic
903467041 1:23559017-23559039 TGTCTGATTAGAGGAAAAGAGGG + Exonic
903493114 1:23744004-23744026 TGTTCGCTGGGAGGAGAAGACGG + Intronic
903940127 1:26924131-26924153 TTTTTCATTGGAGGAGAAGAAGG + Exonic
904673939 1:32186290-32186312 TGTGTGACTGGAGGAGAGGACGG + Intronic
905118337 1:35661644-35661666 TCTTTGATTGGAGAAGAAGAGGG - Intergenic
905167278 1:36090036-36090058 AGTTTGATAGGAGGAGAAGCAGG + Intronic
905730140 1:40292253-40292275 TGTTTGCTTGGGGGAGAATAAGG + Intronic
908218698 1:61981594-61981616 AGTATGACTGGAGGACAAAAGGG + Intronic
908841459 1:68284275-68284297 AGTATGACTGGAGGACAAAAGGG - Intergenic
908930385 1:69311114-69311136 CGATTGATTGGAGTACCAGAAGG - Intergenic
909583045 1:77259645-77259667 TGTGAGATTGGAGGTCAGGATGG + Intergenic
909996177 1:82282391-82282413 TGTTGGGTTGGAGGAAAACATGG + Intergenic
910065539 1:83146367-83146389 TGTTTGATGGGAGGGTAAGCAGG + Intergenic
910309013 1:85801955-85801977 TATTTGATTGGGAGACATGAGGG - Intronic
910325781 1:86004969-86004991 TGTTTGACAGGAGTACAAGAAGG - Intronic
910783982 1:90974131-90974153 AGTATGATTAGAGGACAAAAGGG - Intronic
911508695 1:98785259-98785281 TGATTGATTGGAGTACCAGAAGG + Intergenic
911900547 1:103497793-103497815 ACTATGATTGGAGGACAAAAGGG - Intergenic
912607720 1:111009254-111009276 TGATTGATTGGAGTACCTGAAGG + Intergenic
912725649 1:112057051-112057073 TGCTTGATTAGAGGGCTAGAAGG + Intergenic
915025949 1:152829979-152830001 TGTGTAATAGGAGTACAAGAAGG - Intergenic
915370759 1:155348152-155348174 TATTTGATCTGGGGACAAGAAGG - Intronic
915580671 1:156811180-156811202 TGTTTGATTTCATGTCAAGAGGG - Intronic
915898902 1:159832515-159832537 AGTTTTCTAGGAGGACAAGAAGG + Intronic
916017834 1:160765834-160765856 TGTCTGAGGGGAGGAGAAGATGG + Intergenic
916265785 1:162888618-162888640 TGTATGGTGGGAGGACAAGGAGG + Intergenic
916354855 1:163893530-163893552 AGTATGATTAGAGGACAAAAGGG + Intergenic
916642085 1:166741100-166741122 TGTGGGGTGGGAGGACAAGAGGG + Intergenic
917356277 1:174130092-174130114 TGATTGATTGGAGTACCTGAAGG - Intergenic
917412851 1:174777925-174777947 TGTGTAATTGGAGGACCTGAAGG + Intronic
917546098 1:175969546-175969568 AGTATGATTGGAGGACAAAGGGG - Intronic
917815525 1:178706137-178706159 AGTTTGATGGGAGGACAAGGTGG + Intergenic
918156370 1:181850621-181850643 TGATTGATTGGAGTACCAGAAGG + Intergenic
918168893 1:181976322-181976344 TGATTGATTGGAGTACCTGAAGG + Intergenic
919518476 1:198556834-198556856 TGTTTTATTGGAAGTGAAGATGG + Intergenic
920091055 1:203453536-203453558 TGTTTGTTGGAAGGACAAGTGGG + Intergenic
921404454 1:214764309-214764331 TGTTTGATTGTGGTATAAGATGG + Intergenic
921736263 1:218632405-218632427 CGATTGATTGGAGTACGAGAAGG - Intergenic
921738140 1:218652393-218652415 CGTTTGATTGGAGTACCAGAAGG - Intergenic
922034894 1:221838823-221838845 AATATGATTGGAGGACAAAAAGG + Intergenic
922893295 1:229078407-229078429 TGCTTGCTTGGAGGAAAAGTTGG - Intergenic
923411315 1:233712856-233712878 GGTTTGAGTGCAGGAGAAGATGG - Intergenic
923970966 1:239202855-239202877 TGTTTGACAGCAGGAAAAGATGG - Intergenic
924492263 1:244549996-244550018 TGTCTGAGTGCAGGAGAAGATGG - Intronic
924563735 1:245178825-245178847 TGTCTGAGTGGAGGGCAAGTGGG + Intronic
1064098339 10:12441083-12441105 CGTATGATTGGAGGACGAAAGGG - Intronic
1064507522 10:16049414-16049436 TGTGTGTTTGCAGGAAAAGAAGG - Intergenic
1066047526 10:31606315-31606337 TTTTTGATTTGAGGCCAAGAAGG + Intergenic
1067077732 10:43197677-43197699 TGTGGGATTGGAGGTCAGGAGGG - Intronic
1067199847 10:44157778-44157800 TGTATAATTGGAGTGCAAGAAGG + Intergenic
1068126728 10:52850236-52850258 TGATTGATTGGAGTACCAGAAGG - Intergenic
1068235603 10:54228657-54228679 TGTTTGATGGCAGGAGAAGATGG + Intronic
1069109957 10:64435063-64435085 AGTATGATTGGAGGACAAAAGGG + Intergenic
1069554047 10:69385132-69385154 TTTTTGCTTGGAGGACCAGAAGG - Intronic
1071059217 10:81549634-81549656 TGATTGATAGGAGCACCAGAAGG + Intergenic
1071077066 10:81767768-81767790 TAATTGATTGGAGTACCAGAAGG - Intergenic
1071134414 10:82437159-82437181 TGATTGATTGGAGTACCAGAAGG - Intronic
1072090959 10:92126684-92126706 TGTATGATTGGTGGAAAAGGAGG - Intronic
1073635313 10:105192252-105192274 GTTTTGATTGGAGGATAAAAGGG - Intronic
1073772936 10:106755261-106755283 TCTTTTATTGGAGGATGAGAAGG + Intronic
1073833095 10:107409427-107409449 TGTGTCATTGGAGGACAACCTGG + Intergenic
1074218320 10:111409869-111409891 GGATTGATTGGAGGGCAAGGAGG - Intergenic
1074330376 10:112501236-112501258 TTTTTGGTTTGAGTACAAGATGG + Intronic
1076596973 10:131629589-131629611 TGTTTGATTTGTGGCCCAGAAGG + Intergenic
1079054152 11:17190869-17190891 TGTGTAATTGGAGTCCAAGAAGG + Intronic
1079426218 11:20344193-20344215 TGATTGATTGGAGTACCTGAAGG + Intergenic
1079966227 11:26983528-26983550 TGATTGATTGGAGTACAAGAAGG - Intergenic
1080130743 11:28791936-28791958 TGATTGATTGGAGTACCTGAAGG - Intergenic
1080964295 11:37196188-37196210 TGTTTGTATGGCTGACAAGAAGG - Intergenic
1081049279 11:38316681-38316703 TGTTTGTTTGGAGGAAAGTAAGG + Intergenic
1081205093 11:40265866-40265888 TGTTTGTTTGCAAGACGAGAAGG + Intronic
1081440149 11:43071778-43071800 AGATTAATTGGAGGAAAAGAGGG + Intergenic
1081454803 11:43211318-43211340 TGATTGATTGGAGTACCAGAAGG - Intergenic
1082069686 11:47929005-47929027 TGTTTGATTAGGGGAAAATAGGG - Intergenic
1083563265 11:63691626-63691648 TTTTTGATTTGAGCAAAAGAAGG - Intronic
1083717216 11:64584320-64584342 TCTGTGTTGGGAGGACAAGAGGG - Intergenic
1086425479 11:86678435-86678457 TGTTTGTTTGGAGGTCAGGGTGG + Intergenic
1086771532 11:90773762-90773784 TGATTGACTGGAGTACCAGAAGG - Intergenic
1087199513 11:95331617-95331639 AGTTTGATGGGAGGAAAAAAGGG - Intergenic
1087580707 11:100048185-100048207 TGTCTGATGGTAGGAGAAGACGG - Intronic
1088167473 11:106955920-106955942 CGATTGATTGGAGTACCAGAAGG - Intronic
1090172835 11:124619743-124619765 TGTTAGCTCGGAGGAAAAGAAGG - Exonic
1090545570 11:127763232-127763254 TGTGTAATTGGAGCACCAGAAGG - Intergenic
1091050359 11:132362936-132362958 ATTATGATTGGAGGACAAAAGGG + Intergenic
1092639940 12:10494766-10494788 CGATTGATTGGAGTACCAGAAGG + Intergenic
1092996584 12:13956865-13956887 TCTTTAATTGCAGGACTAGAGGG - Intronic
1093240282 12:16661913-16661935 TGTGAGATTGGAGGTGAAGAGGG + Intergenic
1093413509 12:18894846-18894868 TGATTGATTGGAGTACCTGAAGG - Intergenic
1093522651 12:20068292-20068314 TGATTGATTGGAGTACCATAAGG + Intergenic
1093808613 12:23465764-23465786 TGATTGATTGGAGTACTGGAAGG + Intergenic
1095357673 12:41295315-41295337 TTTTTGATTTGATGACAATATGG - Intronic
1095432470 12:42148825-42148847 TGTTGGACTGGAGGAAAAGTTGG + Intergenic
1095532428 12:43204103-43204125 TGTATAATTGGAGACCAAGAAGG + Intergenic
1095777842 12:46029002-46029024 TCTTAGATTTGGGGACAAGATGG + Intergenic
1097870254 12:64596009-64596031 TGTTTGACTGTAGGTCAACAAGG + Intergenic
1098217687 12:68237351-68237373 TGATCTTTTGGAGGACAAGAAGG - Intergenic
1099793117 12:87362278-87362300 TGATTGATTGGAGTACCAGCTGG - Intergenic
1099825129 12:87766396-87766418 TCTTTGCTTACAGGACAAGAGGG - Intergenic
1101804215 12:108049202-108049224 TGTTTGAAAGGAGGACAAAAAGG + Intergenic
1103657814 12:122487634-122487656 TGATTGAATTGAGTACAAGAAGG - Intronic
1106172280 13:27298279-27298301 TGTGTAGTGGGAGGACAAGAAGG + Intergenic
1106889983 13:34234840-34234862 TGATTGATTGGAGTACCAGAAGG - Intergenic
1108826972 13:54423951-54423973 TGTTTGATTCTAGTACAATATGG - Intergenic
1109373923 13:61463521-61463543 TGTTTGAATAGAGAACAATAAGG - Intergenic
1109882646 13:68500753-68500775 TGTTAGATGGGAGCACAAGGAGG + Intergenic
1110174920 13:72544781-72544803 TGTTTGAATGGATAACTAGATGG + Intergenic
1110790341 13:79580805-79580827 TGATTGATTGGAGTACCTGAAGG - Intergenic
1111693482 13:91593383-91593405 TACATGACTGGAGGACAAGATGG - Intronic
1112121439 13:96416585-96416607 TGATTGATTGGAGAACATAAAGG + Intronic
1114176983 14:20330878-20330900 TTTTTGCTTGAAGGACAATATGG - Intronic
1114905699 14:27123218-27123240 TGTTTCATTAGAGCACAAGATGG - Intergenic
1118463681 14:66011871-66011893 GGTTTGATTGGAGAAAAAAAAGG - Intergenic
1120451709 14:84676668-84676690 TGATTTATTGCATGACAAGATGG + Intergenic
1122001274 14:98656521-98656543 TGTGTAATTGGAGGTCCAGAGGG + Intergenic
1122661777 14:103300912-103300934 TGTGTGATTGGAGGTCAGCATGG - Intergenic
1123896621 15:24836815-24836837 AGTATGATTGGAGGACAAAAGGG + Intronic
1125058768 15:35393500-35393522 AGTATGAATGGAGGACAAAAGGG + Intronic
1126520979 15:49593254-49593276 TGTGTGATTGGTGCAGAAGACGG - Intronic
1126552840 15:49952318-49952340 TGATTGATTGGAGGACCAGAAGG - Intronic
1126671615 15:51120632-51120654 AGTATGATTGGAGGACAGAAGGG + Intergenic
1126892746 15:53223564-53223586 TGTGTGAGTAGAGGACAATAGGG + Intergenic
1128746097 15:70115160-70115182 TGTGTCATAGGAGGACATGATGG + Intergenic
1128995760 15:72293207-72293229 TGTTTGACAGGAGGATAAGCTGG + Intronic
1131303210 15:91218194-91218216 AATATGATTGGAGGACAAAAGGG + Intronic
1133034370 16:3026791-3026813 TGGCTGGTTGGAGGGCAAGATGG + Intronic
1133890129 16:9871129-9871151 GGTGTGACAGGAGGACAAGATGG - Intronic
1135792958 16:25414869-25414891 TGAATGAATGGAGGGCAAGAAGG + Intergenic
1138244630 16:55458314-55458336 GGTTGTATTGGAGGACGAGATGG + Intronic
1138405011 16:56785195-56785217 TGTTTGGTTGGATGACATGGGGG + Intronic
1138706347 16:58919729-58919751 TGATTTTTTGGAGGAGAAGAAGG + Intergenic
1140151816 16:72375125-72375147 AGCTTGATTGGAGGACAAAGTGG + Intergenic
1140810785 16:78575476-78575498 TGTCTGCATGGAGGACAAGAAGG + Intronic
1143714412 17:8756685-8756707 TGTCTGATGGGAGGACATCATGG - Intronic
1146678101 17:34787266-34787288 TGTTTGATTGGGGGACACTGGGG - Intergenic
1149019965 17:51951595-51951617 TTTTTGCATGGAGGACAAAAAGG - Intronic
1149671437 17:58416123-58416145 TTTTTTAATGGAGGAGAAGAGGG + Exonic
1150091269 17:62327483-62327505 TGTTCTATTGTAGAACAAGATGG + Intergenic
1150477409 17:65485629-65485651 TGTCTGCTTTGATGACAAGAGGG - Intergenic
1151192292 17:72407379-72407401 TCTCTGATTGGTGGCCAAGAAGG + Intergenic
1151415988 17:73964666-73964688 TGTGTAATTGGAGTACTAGAAGG - Intergenic
1152313784 17:79567850-79567872 TGTTGAATTGGAAGAAAAGAGGG - Intergenic
1152855070 17:82660883-82660905 TGGATGATTGGAGGACAAGGCGG - Intronic
1152940480 17:83169830-83169852 TGTGTGATGGGAATACAAGAAGG - Intergenic
1153833169 18:8940889-8940911 AGTGTGATTGGAGGACAGGAGGG - Intergenic
1153846581 18:9055392-9055414 TGTTTGGTTTTAGGACAAAATGG - Intergenic
1154316279 18:13306294-13306316 CTTTTGATTGTAGAACAAGAAGG + Intronic
1154975992 18:21458354-21458376 TGTTTGAATGGAGGGCTAGAAGG + Intronic
1155847958 18:30732452-30732474 TGATTGATTGGAGTACATGAAGG + Intergenic
1156230126 18:35145773-35145795 TCTTTGTTTGCAGGACAGGATGG - Intergenic
1157102185 18:44741285-44741307 TGGCTGATGGGAGGATAAGAGGG + Intronic
1157685814 18:49641406-49641428 TTTTTGATTGGAGGGAAAAATGG + Intergenic
1160074100 18:75655515-75655537 TCTTTGATTTGGGGAGAAGAGGG + Intergenic
1160377446 18:78423688-78423710 TGTTAGATTATATGACAAGAGGG - Intergenic
1162248971 19:9426424-9426446 TGGTTGATAAGAGGAAAAGAAGG - Intronic
1164629140 19:29750056-29750078 TGTTTGGTTTGAGGAGAGGAGGG - Intergenic
1165561870 19:36687297-36687319 TGTTTGATGCCAGGACAAGGCGG - Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166536284 19:43576871-43576893 TGTTTGCTTGAAGACCAAGACGG - Intronic
1167709239 19:51099813-51099835 TGTTTGGTTGTAGGACAAAGGGG + Intronic
926927811 2:18005307-18005329 TGTTTGATTGAACGACCAGAAGG + Intronic
927408141 2:22795808-22795830 TGCCTGATTGTAGGATAAGATGG + Intergenic
927550306 2:23992372-23992394 AGTATGATTGGAGGGCAAAAGGG + Intronic
928803850 2:35126744-35126766 CGATTGATTGGAGTACCAGAAGG + Intergenic
929600061 2:43199346-43199368 CGGTTGATGGGAGGAGAAGAAGG - Intergenic
929824366 2:45298872-45298894 TGATGGCTTGGTGGACAAGAAGG - Intergenic
932013631 2:68002004-68002026 TGATTGATTGGAGTACCTGAAGG + Intergenic
932826897 2:74949218-74949240 TGATTGATTGGAGTACCAGAAGG + Intergenic
936742386 2:115528881-115528903 TGTTTTATGGGACAACAAGAGGG + Intronic
936810611 2:116396383-116396405 TGTATCATTGGAGTACAAGAAGG - Intergenic
939291710 2:140204361-140204383 TGTTTGATTAGATGAAATGAAGG - Intergenic
939809124 2:146809402-146809424 TGATTGACTGGAGTACCAGAAGG + Intergenic
941615864 2:167718696-167718718 AGTGTGATGGGAGGACAAAAGGG + Intergenic
941742663 2:169052587-169052609 AGTGTGACTGGAGGACAAAACGG + Intergenic
942106887 2:172642179-172642201 TGTTTGATTGTAGGAAAAAAAGG + Intergenic
942212624 2:173686652-173686674 AGTGTGATTGGAGGACAAAGGGG - Intergenic
942924238 2:181412623-181412645 TGATTGATTGGAATACCAGAAGG + Intergenic
944345967 2:198666307-198666329 TGTTTGTTTGGTGGCCGAGAGGG - Intergenic
944383492 2:199138907-199138929 TGGTTGTTTGGAGGGCAGGAAGG + Intergenic
945298876 2:208197619-208197641 AGTATGATTTGAGGACAAAAGGG + Intergenic
946605299 2:221398130-221398152 TGTTTGAGAGCAGGAGAAGATGG - Intergenic
947260388 2:228215275-228215297 TGTCTGATAGCAGGAGAAGATGG - Intergenic
1169048571 20:2558067-2558089 AGTATGATCGGAGGACAAAAGGG + Intronic
1169959501 20:11143292-11143314 CGCTTGAGTGGAGGAAAAGATGG + Intergenic
1171028267 20:21652745-21652767 TGTTTGATGAGAGGAAAGGAAGG + Intergenic
1173742490 20:45411062-45411084 TGTTGGATTTGAGGAAATGAAGG + Intergenic
1173911572 20:46674634-46674656 TGTTTGTTTGGAGGAGTGGAAGG + Intronic
1174616008 20:51836002-51836024 TGTTATATTGGAGGAAAAGCAGG - Intergenic
1174833128 20:53832133-53832155 TCTTAGATTGGTGGGCAAGAAGG - Intergenic
1174916960 20:54663785-54663807 AGTATGAATGGAGGACAAAAGGG + Intergenic
1174963069 20:55179932-55179954 TGATTTATTGCAGGAAAAGATGG - Intergenic
1175801769 20:61805081-61805103 TGTTTGCTGGAATGACAAGAAGG - Intronic
1178116979 21:29427582-29427604 TGTTTGTTGGGATGACAACATGG + Intronic
1179681627 21:43025528-43025550 TGTTTGACAGCAGGACTAGAAGG - Intronic
1180017125 21:45094692-45094714 GGTTGGATGGGAGGACAGGAAGG - Intronic
1182693509 22:32180077-32180099 GGTTTAATTGTAGGACCAGAGGG - Intergenic
1183323148 22:37177316-37177338 TGTTTGGCTGGAGGACTGGAGGG - Intergenic
1183498184 22:38162484-38162506 TGTGTGGGTGGAGGACTAGAGGG + Intronic
949279342 3:2328080-2328102 AGTATGATTGGAAGACAAAAGGG - Intronic
949466065 3:4345052-4345074 TGATTGATTGGAGTACCAGAAGG + Intronic
949490466 3:4584247-4584269 AGTTGGTTTGGGGGACAAGAAGG - Intronic
951630833 3:24718148-24718170 TGTTTACTGGGAGGACAAGGGGG - Intergenic
951679492 3:25280173-25280195 AATATGATTGGAGGACAAGAGGG + Intronic
952480606 3:33757428-33757450 AGTTGGATTGGAGAACAAGATGG - Intergenic
952634178 3:35506643-35506665 TGATTGATTGGAGTACCTGAAGG + Intergenic
953151651 3:40330537-40330559 TGAGTGATTGGAGCACAGGATGG + Intergenic
953857836 3:46514789-46514811 AATATGATTGGAGGACAACACGG - Intergenic
954724374 3:52595238-52595260 TGTTTGATTGTGGTATAAGATGG + Intronic
955698147 3:61657122-61657144 AGTATGATTGGAGGACAAAGGGG + Intronic
955757248 3:62237866-62237888 GGTTTGATTGGAAGTCCAGAGGG - Intronic
956014470 3:64867236-64867258 AGTATGATTGGAAGACAAAAAGG + Intergenic
956138629 3:66123707-66123729 AGTATAATTGGAGGACAAAAGGG - Intergenic
956658185 3:71573279-71573301 TGTGTGATTTCAGGACAAAAAGG + Intronic
957291506 3:78282826-78282848 TGATTGATTGGAGTATCAGAAGG + Intergenic
957629937 3:82706025-82706047 TGTTTGATTGGAGTACCTGAAGG - Intergenic
957898294 3:86452116-86452138 GGTATCATTGGAGGTCAAGAGGG + Intergenic
958656327 3:97008228-97008250 TGATTGATTGGAGTACCAGAAGG - Intronic
959205690 3:103303810-103303832 TGGGTGATTGGAGTACCAGAAGG - Intergenic
959306608 3:104674689-104674711 TGGTGAATTGGAAGACAAGATGG - Intergenic
959721256 3:109491987-109492009 TGTTTGATTTGATGACATTATGG - Intergenic
960413883 3:117360251-117360273 TGATTAATTGGAGTACCAGAAGG + Intergenic
961076506 3:123987474-123987496 AATTTTATTGGAGGGCAAGATGG - Intronic
961167291 3:124772261-124772283 TGTTTAATTGGAGGAGATGGGGG - Intronic
963571844 3:147008149-147008171 TGTTTGTTTGGAGGAAAGTAAGG - Intergenic
964831370 3:160887228-160887250 TGATTGATTGGAGTACCTGAAGG + Intronic
965694226 3:171390333-171390355 TGTTTGAATGCAGCACAAGTAGG + Intronic
965737603 3:171838185-171838207 TGTTTGTAGGGAGGACAACAGGG - Intergenic
965954386 3:174351095-174351117 TATTTGATTTGAGGAGCAGATGG - Intergenic
965970953 3:174555631-174555653 AGTATGATTGGAGGACAAAAGGG + Intronic
966247457 3:177825013-177825035 TGATTCCTTGGAGGAGAAGATGG - Intergenic
967404895 3:189104463-189104485 AGTCTGATTAGAAGACAAGATGG - Intronic
967837391 3:193976198-193976220 TGTTTGTTTGGAGAGAAAGAGGG + Intergenic
968151003 3:196336530-196336552 TGTTTGATTGGCGGACAGCCAGG - Intronic
969017299 4:4112091-4112113 TATTTGAATGGATGATAAGAAGG + Intergenic
970774978 4:19662812-19662834 TGTTTAATTGGAGTCCTAGAAGG + Intergenic
971033444 4:22666681-22666703 AGTGTGATTGGAGGACAAAAGGG + Intergenic
971429444 4:26549398-26549420 TGTTTGATTTCAAGACAGGATGG + Intergenic
971516793 4:27497329-27497351 TGATTGATTGGAGTACCTGAAGG + Intergenic
973152178 4:46901767-46901789 TGTTTGAGGGCAGGAGAAGATGG - Intronic
974529542 4:63089868-63089890 TGTTTAATGGCAGGAGAAGATGG + Intergenic
974768814 4:66384060-66384082 TGATTGATTGGAGTACCAGAAGG + Intergenic
976500501 4:85783140-85783162 AGTGGAATTGGAGGACAAGAAGG + Intronic
976538043 4:86241451-86241473 CAATTGATTGGAGTACAAGAAGG - Intronic
977131333 4:93242481-93242503 TGTTTGATAGCAGTACAACAAGG + Intronic
978136403 4:105266778-105266800 TGTGTAATTGGAGTACCAGAAGG + Intronic
978987736 4:115034991-115035013 TTATTGATTGGGGGAGAAGATGG - Intronic
979583732 4:122390482-122390504 TGATTGACTGGAGTACCAGAAGG - Intronic
979775592 4:124584588-124584610 TGATTGATTGGAGTACCAGAAGG + Intergenic
981187177 4:141817221-141817243 TGGTTGATTGGAGTACCTGAAGG + Intergenic
981403282 4:144339115-144339137 AGTATGATTGGAAGACAAAAGGG - Intergenic
981645120 4:146990682-146990704 TGTTTGATTGTAGTATAAGGTGG + Intergenic
982528382 4:156507112-156507134 TGATTGATTGGAGTACCTGAAGG + Intergenic
984298524 4:177885395-177885417 TGTTTGAGAGTAGGAGAAGATGG - Intronic
984376798 4:178941776-178941798 TAATTGATTGTAGGAAAAGAAGG + Intergenic
984625952 4:182008357-182008379 CGATTGATTGGAGTACCAGAAGG - Intergenic
985314807 4:188645949-188645971 AGTGTGATTGGAGGACAAACGGG + Intergenic
986644462 5:9903149-9903171 TGTTTGATAGCAGAACAAGGTGG - Intergenic
986775861 5:11013206-11013228 AGTCTGATTGGAGGACAAAAGGG - Intronic
988059645 5:26150039-26150061 TGATTGACTGGAGTACCAGAAGG + Intergenic
989004892 5:36799351-36799373 TGTTTGATTGGTGGATATGTAGG + Intergenic
990138932 5:52681296-52681318 CGATTGATTGGAGTACCAGAAGG - Intergenic
992376399 5:76192083-76192105 TGTTTGAGGGGAGGAGATGAAGG - Intronic
992412435 5:76519433-76519455 AGTTTGTTTGGAGGACATGTGGG + Intronic
993105854 5:83599936-83599958 TGCTTAATTGGAGTACAGGAAGG - Intergenic
993398296 5:87417754-87417776 TGATTGATTGGAGAATAAGAGGG + Intergenic
994425604 5:99581449-99581471 AGTATGATTGGAGGACAAAAGGG - Intergenic
994435737 5:99730792-99730814 AGTATGATTGGAGGACAAAAGGG + Intergenic
994994214 5:107039052-107039074 AGTACGATTGGAGGACAAAAGGG + Intergenic
995477410 5:112562246-112562268 AGTATGATTGGAGTACAAAAAGG + Intergenic
995685202 5:114765213-114765235 TGATTGATTGGAGTGCCAGAAGG - Intergenic
996558378 5:124802087-124802109 AGTGTGATTGGACGACAAAAGGG + Intergenic
996623860 5:125545085-125545107 AGTATGATTGGAGGATAAAAGGG + Intergenic
996795958 5:127347718-127347740 TTTTTTATTGGAGGCCAAAAGGG - Intronic
996987899 5:129590678-129590700 TGTTTCATTAAAAGACAAGAAGG - Intronic
997067667 5:130581121-130581143 TGATTGATTGGAGTACCTGAAGG + Intergenic
997208765 5:132065739-132065761 TTTTTCATTGGAGGAGAAGATGG + Intergenic
998601190 5:143586901-143586923 TGTTTGAATGAATGGCAAGAGGG - Intergenic
1000707270 5:164527114-164527136 TGGTTGATTGGAGAACACGAAGG + Intergenic
1002972736 6:2040837-2040859 AGTGTGATTGGAGGATAACAGGG - Intronic
1003686944 6:8313950-8313972 TAATTGATTGGAGTACCAGAAGG - Intergenic
1004847239 6:19658426-19658448 AATATGATTGGAGGACAAAAGGG - Intergenic
1005120872 6:22388586-22388608 TGATTGATTGGAGTACCTGAAGG - Intergenic
1005179007 6:23082243-23082265 TGTGTGATTGGGGGGCAGGATGG + Intergenic
1005583712 6:27256230-27256252 TATTTGATTGTGGGAAAAGATGG - Exonic
1005948302 6:30611599-30611621 TTTTTGTTGGGAGGACAAAAAGG - Intronic
1006876666 6:37303541-37303563 TGTTTGAATGGTGTGCAAGATGG - Intronic
1008154034 6:47991047-47991069 TGTTTGATTGGAGGACAAGAGGG + Intronic
1008468096 6:51853546-51853568 TGATTGATTGGAGTACCAGAAGG - Intronic
1008741708 6:54616277-54616299 TGATTGATTGGAGTGCCAGAAGG + Intergenic
1008773487 6:55008004-55008026 TGATTGATTGGAGTACCAGAAGG - Intergenic
1008955857 6:57214609-57214631 TGTTTCAATGGAAGACAAGCAGG + Intronic
1009054464 6:58317950-58317972 TGTTTGATTGGTGTACTTGAAGG + Intergenic
1009236674 6:61132624-61132646 TGTTTGATTGGTGTACTTGAAGG - Intergenic
1010165792 6:72913881-72913903 AATATGATTGGAGGACAAAAGGG + Intronic
1010637211 6:78275570-78275592 TGTTTGATAAGGGGACAACATGG - Intergenic
1011812358 6:91147378-91147400 TATTTTATTGGAGGCCAAGAAGG + Intergenic
1013063973 6:106665158-106665180 TGTTTTATTGTATAACAAGATGG + Intronic
1014367397 6:120561828-120561850 TGATTGATTGGAGTACCAGAAGG - Intergenic
1015824659 6:137298778-137298800 AGTATGATTAGAGGACAAGATGG - Intergenic
1015836494 6:137425955-137425977 AGTGTGATTGGAGGACAAAGGGG + Intergenic
1016400088 6:143670898-143670920 TGATTCTTTGGAGGAGAAGAAGG + Intronic
1016405276 6:143723541-143723563 TGTATGAATGGATGACAAGGAGG - Intronic
1016801005 6:148168927-148168949 AGTATGATTGGAGGACAAACGGG + Intergenic
1016969190 6:149746951-149746973 TATTTGTTTGGGAGACAAGAGGG - Intronic
1018651900 6:165999175-165999197 TGTGTGATTGGAGAAGAAGGAGG - Intergenic
1020621947 7:10529127-10529149 CGATTGATTGGAGTACCAGAAGG + Intergenic
1022068803 7:26889045-26889067 GGTATGATTGGAGGACGAAAGGG + Intronic
1023700726 7:42889341-42889363 TGGTTGATAAGAGGAAAAGAGGG - Intergenic
1024492338 7:49999651-49999673 TGTTTGAGGGAAGGAGAAGATGG + Intronic
1026213348 7:68326258-68326280 TGTTGGATTGGATGGCAAAAAGG + Intergenic
1027420944 7:78017680-78017702 TGTTTGACAGGAGGAGAATAAGG - Exonic
1027560603 7:79724300-79724322 AGTATTATTGGAGGACAAAAGGG + Intergenic
1028810773 7:95083231-95083253 ACTATGATTGGAGGACAAAAGGG + Intronic
1029039651 7:97559037-97559059 TGATTGATTGGAGTACGAGAAGG + Intergenic
1029993423 7:104983782-104983804 TGCTTTTTTGGAGGGCAAGAGGG + Intergenic
1030107936 7:106002373-106002395 AGTATGATTGGAGGACAAAAGGG + Intronic
1030540989 7:110830562-110830584 TTTTTGTTTGCAGTACAAGATGG - Intronic
1030794337 7:113769785-113769807 TCTTTTTTTGGAGGACTAGATGG - Intergenic
1032247676 7:130226726-130226748 GGTTTGAGTGGAGGAAAAGGAGG + Intergenic
1033427710 7:141260286-141260308 TGTTTCATTGGAGGAAGAGGTGG + Intronic
1034351299 7:150416519-150416541 TGTGTGATTGGAGGACAAGAGGG - Intergenic
1034384434 7:150727510-150727532 TGTTTGAAGGCAGGAGAAGATGG - Intronic
1034709711 7:153180346-153180368 TGTTTGTTTGGATCACAAGAGGG - Intergenic
1035599333 8:887999-888021 CGATTGATTGGAGTACCAGAAGG - Intergenic
1038158199 8:25011109-25011131 TTTTTCTTTTGAGGACAAGAAGG - Intergenic
1039711397 8:40059223-40059245 TTTTTGATTGGAATATAAGATGG - Intergenic
1041611236 8:59851742-59851764 TGTTTGATTGCAGCAGATGAAGG - Intergenic
1041814513 8:61954041-61954063 TGATAGTTTGGAGGACAAAATGG + Intergenic
1043239756 8:77918022-77918044 TGTTTGAATGGAGAAGAAGTTGG + Intergenic
1044231595 8:89785185-89785207 TGTTTCATGGGTGGACACGATGG + Intronic
1044355994 8:91223798-91223820 CGATTGATTGGAGTACCAGAAGG - Intronic
1044394212 8:91690848-91690870 GTTTTGATTGGAGTAAAAGATGG - Intergenic
1045863742 8:106841389-106841411 TGTCTGAGGGTAGGACAAGATGG + Intergenic
1045868900 8:106902901-106902923 TGTTGGATTTGAAGACAAAAGGG - Intergenic
1045911879 8:107419461-107419483 AATGTGATTGGAGGACAAAAGGG - Intronic
1047886095 8:129251567-129251589 AGTTTGTTTGGTGGAGAAGAAGG - Intergenic
1048587547 8:135789462-135789484 TGATTGATTGGAGTACCTGAAGG - Intergenic
1048830814 8:138475515-138475537 TTTTGGGTTGGATGACAAGATGG - Intronic
1049093796 8:140535883-140535905 ATTTTGATTTGAGGTCAAGATGG + Intronic
1049613117 8:143565001-143565023 TCTAAGATTGGAGGGCAAGAGGG - Intergenic
1050527658 9:6560079-6560101 TGGTTGTTTGGAGGAAATGAAGG - Intronic
1050982475 9:12037347-12037369 TGATTGACTGGAGTACCAGAGGG + Intergenic
1057341722 9:94208261-94208283 TATGTGATTGCAGCACAAGAAGG - Intergenic
1057607039 9:96506299-96506321 TTTCTGTTTGGAGGGCAAGAGGG - Intronic
1057973420 9:99579039-99579061 TGTTTAATTGGATTACAGGAAGG - Intergenic
1059596443 9:115725343-115725365 TGATTGATTGGAGTACCTGAAGG + Intergenic
1060022455 9:120143767-120143789 TCTTTCCTTGGAGTACAAGAAGG - Intergenic
1185846123 X:3439845-3439867 TGATTGATTGGAGTACCAGAAGG - Intergenic
1188286135 X:28327496-28327518 AATATGATTGGAGGACAAAAGGG + Intergenic
1188680153 X:32994006-32994028 AGTATGATTGGAGAACAAAAGGG + Intronic
1188913891 X:35886434-35886456 TGTATCATTGGAGTCCAAGAAGG - Intergenic
1192049216 X:67708690-67708712 TGTTCCTTTGGAGGAGAAGAGGG + Intronic
1193780653 X:85697815-85697837 TGATTAATTGGAGTACCAGAAGG - Intergenic
1194021858 X:88701186-88701208 TGATTGATTGGAGTACCAGAAGG - Intergenic
1194058053 X:89162610-89162632 TGATTGATTGGAGTACCTGAAGG - Intergenic
1194703039 X:97137927-97137949 TGTTTATTTGGAGAACAGGACGG + Intronic
1194812939 X:98407853-98407875 AGTATGATTGAAGGACAAAAGGG - Intergenic
1194852122 X:98882326-98882348 TGATTGATTGGAGTACCTGAAGG + Intergenic
1195654372 X:107320828-107320850 TGTGTGAGTGTATGACAAGATGG + Intergenic
1195842900 X:109193541-109193563 TGTTTGATTGGTGTACCTGAAGG + Intergenic
1195877376 X:109556015-109556037 AGTTTGATTTGAGGATCAGAGGG + Intergenic
1197034291 X:121854966-121854988 TGTTTGATTTTAGTATAAGATGG - Intergenic
1197266615 X:124380860-124380882 TGTTGAATGGGAGGACTAGACGG - Exonic
1198491334 X:137144757-137144779 TGTTTGGTGGGAGGACGGGAAGG + Intergenic
1198834841 X:140794184-140794206 TGTTTCATTCCAGGACAGGAAGG - Intergenic
1200805499 Y:7429058-7429080 TGTTCCTTTGGAGGAGAAGAAGG - Intergenic