ID: 1008154406

View in Genome Browser
Species Human (GRCh38)
Location 6:47996169-47996191
Sequence CAGAATCAGGAGAGAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 434}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008154406 Original CRISPR CAGAATCAGGAGAGAGTGGC TGG Intronic
900298788 1:1966220-1966242 CACACACAGGAGAGGGTGGCGGG + Intronic
900331442 1:2136658-2136680 GGGACTCAGGAGAGTGTGGCTGG + Intronic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
900875821 1:5341780-5341802 CAGGCACAGGAGAGAGGGGCTGG + Intergenic
900997689 1:6131251-6131273 CAGAGGCAGGAGAGAGTGAAAGG - Intronic
901168375 1:7236033-7236055 CATAAACAGCTGAGAGTGGCCGG + Intronic
903644521 1:24886522-24886544 CAGAAAGAGGAGGGAGTGGCTGG - Intergenic
903758912 1:25684198-25684220 CAGTATCGGGGGAGAGAGGCAGG - Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
905202936 1:36326069-36326091 CAGGATCTGGGGAGAGTGTCTGG + Intronic
906150726 1:43585966-43585988 CAGAATTAGCAGAGGCTGGCAGG - Intronic
906158635 1:43630061-43630083 CAAAATCAGGAGGTAGTGGTAGG - Intergenic
906399695 1:45495952-45495974 CAGAGGGAGGAGAGATTGGCAGG - Intronic
907243639 1:53093901-53093923 CAGGAGCAGGAGGGAGAGGCAGG - Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907406098 1:54254382-54254404 CGGGTTTAGGAGAGAGTGGCTGG - Intronic
908334858 1:63111422-63111444 AAGAATCAGGAGTTTGTGGCCGG - Intergenic
909033335 1:70567499-70567521 CAGGCTCAGGAGAGAGTGTAAGG + Intergenic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
910870158 1:91826156-91826178 CAGAGTCGAGAGAGAGTGACAGG + Intronic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
913139928 1:115931040-115931062 CAGGAGGAAGAGAGAGTGGCGGG - Intergenic
913334716 1:117698600-117698622 CAGCAGCAGGAGAGAGGGGTGGG + Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914975476 1:152356961-152356983 CAGGTTCAGGAGACAGTGGGAGG - Exonic
915400307 1:155617110-155617132 CAGAATTAAGAGTGTGTGGCCGG - Intergenic
915684417 1:157617140-157617162 AAGAAACAGGAGATAGTTGCAGG + Intergenic
916192915 1:162196636-162196658 CAGAAACAGGAAAGAGATGCTGG + Intronic
916291002 1:163166108-163166130 TAGAAGCAGGAGAGAAAGGCGGG + Intronic
917163687 1:172087196-172087218 GAAAACCAGGAGAGAGTGGAAGG - Intronic
917516479 1:175712697-175712719 CAGAAGCAAGAGAGAGAGGGTGG - Intronic
917906290 1:179589418-179589440 CACAAGCAGGAGAGAGCGACAGG + Intergenic
917918432 1:179728048-179728070 CAGAAAAAGGAGACAGTAGCTGG + Intergenic
919356996 1:196536888-196536910 CAGGCTCATGAGAGTGTGGCAGG - Intronic
920402005 1:205681786-205681808 CAGAGCCAGGAGAGAGTGGACGG + Intergenic
922356291 1:224779521-224779543 CAGGAGCAGGAGAGAGAGGGTGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
1064125365 10:12655246-12655268 CAGGATCGAGAGAGAGTGGGAGG + Intronic
1064464217 10:15563058-15563080 CAGAACCAAGAGAGAGAGGGTGG - Intronic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1065180643 10:23121310-23121332 CAGGAGCAAGAGAGAGTGGTAGG + Exonic
1065943570 10:30587094-30587116 CAGAATCAGGGCACAATGGCAGG - Intergenic
1066542056 10:36458030-36458052 CAGGATCAGGTGATAATGGCAGG - Intergenic
1068401751 10:56536721-56536743 CAGAATCAGGATTGAGTAGAGGG + Intergenic
1070438840 10:76422514-76422536 CAGACTGAGGAGAGCATGGCGGG - Intronic
1070505110 10:77106322-77106344 CAGAGCCAGAACAGAGTGGCAGG + Intronic
1071499447 10:86193105-86193127 GGGAATGAGGAGAGAGTGGAGGG - Intronic
1071563430 10:86659692-86659714 CAGAATCAAGAGGGAGTAGGGGG + Intronic
1073554587 10:104436550-104436572 CAGGAACAGGAGAGAGTGGGAGG + Intronic
1073701597 10:105933972-105933994 CAGAAGCAAGAGAGAGTGATGGG - Intergenic
1073989493 10:109246221-109246243 CAATATCAGGAGAGACTGGTGGG - Intergenic
1074496702 10:113985924-113985946 CAGAGGCAGGAGAGAGAGACAGG + Intergenic
1074504308 10:114054552-114054574 CAGTAGCAGGAGAGAGTGAATGG + Intergenic
1074645628 10:115449169-115449191 CAGAATCAGGGGAGTGGGGTGGG - Intronic
1074702722 10:116106628-116106650 CAGAACCAAGAGAAAGTGGAGGG - Intronic
1076309827 10:129497381-129497403 CAGAAACAGGAGAGAGGACCAGG - Intronic
1076606356 10:131692111-131692133 CAGAATCAGCAGAGAGTTTTGGG - Intergenic
1077891562 11:6421698-6421720 CAGAAGCAAGAGAGTGTGGGGGG - Intergenic
1078730267 11:13967140-13967162 CAGAATCAGGATACAGTCTCAGG + Intronic
1078730622 11:13970803-13970825 CAAAATCAGGCGAAAGTGACGGG - Intronic
1081804058 11:45880518-45880540 GAGAATCAGGAAAAAATGGCTGG - Intronic
1082076850 11:47981204-47981226 CAGGATCGGGGGAGAGAGGCGGG + Intronic
1082092245 11:48099580-48099602 CACAATCAGAAGAGAGTGACGGG - Intronic
1082249038 11:49959972-49959994 CAGATTTGGGAGAGACTGGCAGG - Intergenic
1083835823 11:65266608-65266630 CAGAATGAGGAGGGAATGGTAGG + Exonic
1083935107 11:65865909-65865931 CGGAACCTGGAGGGAGTGGCAGG + Intronic
1083948692 11:65941566-65941588 CTGATGCAGGAGAGAGTGGGAGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1086314217 11:85573045-85573067 CAGGATCAAGAGAGAGTGTACGG - Intronic
1088694463 11:112355033-112355055 GAGAGTCAGGGGAGAGAGGCTGG + Intergenic
1089005721 11:115089142-115089164 CAGAAGCAAGAGAGAGTGAGGGG - Intergenic
1089157484 11:116413660-116413682 CAACATCAGGAGAGAGGGGAGGG + Intergenic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1089503341 11:118946162-118946184 GAAAATCAGGAGGGAGTGGATGG - Intronic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1090201708 11:124862321-124862343 CAGAAAGAAGAGAGAGTAGCAGG - Intergenic
1090736743 11:129617480-129617502 CAGGAGAAAGAGAGAGTGGCAGG - Intergenic
1091169945 11:133511109-133511131 CAGAATCAGGTGAGAGAGAGTGG - Intronic
1091264629 11:134261109-134261131 CAGAATTGGGAGCGAGGGGCAGG + Exonic
1091947737 12:4563324-4563346 CAAAGTCAGGGAAGAGTGGCTGG - Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092755781 12:11762174-11762196 CAGCATAAGGCAAGAGTGGCAGG - Intronic
1093120479 12:15265661-15265683 CAGAACCAGGAAATAGTTGCAGG - Intronic
1093688356 12:22082235-22082257 CATAATCAGGGCGGAGTGGCAGG - Intronic
1094078295 12:26503086-26503108 CACAAACAAGAGAGTGTGGCTGG + Intronic
1094466898 12:30763024-30763046 CAGAAGCAGGAGTGAGGGGAAGG + Intergenic
1095311692 12:40705864-40705886 CAGGATCAAGAGAGAGTGGCGGG + Intronic
1096528715 12:52230166-52230188 CAGCCTCAGGGGAGAGAGGCAGG + Intergenic
1096589690 12:52649353-52649375 CTCAAGCAGGAGAGAGGGGCTGG - Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1100355990 12:93830149-93830171 CAGATTCAGGTGAGAGTAGGTGG - Intronic
1101048000 12:100830644-100830666 AAGAACCAACAGAGAGTGGCTGG - Intronic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1102700832 12:114837977-114837999 TAGCATAAGAAGAGAGTGGCAGG - Intergenic
1102810428 12:115819576-115819598 CAGGAGCATGAGAGAGTGGGAGG + Intergenic
1102930960 12:116861853-116861875 CAGATTCAAGAGAGAGTTGTAGG + Intronic
1103317610 12:120069138-120069160 AAAAATCAAGAGAGAGAGGCTGG + Intronic
1103915784 12:124374914-124374936 GAGAAGCAGGAGAGACTGGAGGG - Intronic
1104016117 12:124963571-124963593 CAGAATAAAGAAACAGTGGCCGG + Intronic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1105332360 13:19429691-19429713 CAGAGTCGGGAGGGGGTGGCAGG + Intronic
1105546028 13:21351844-21351866 CAGCATCTGGAGAGGATGGCTGG + Intergenic
1106732263 13:32553735-32553757 CACAAGCAGGACAGAGTGGGAGG - Intergenic
1106865515 13:33959982-33960004 CAGGAGCAAGAGAGAGTGTCAGG + Intronic
1107045145 13:35985695-35985717 CAGGCTCAGGAGAGACTGGCTGG + Intronic
1107173721 13:37376232-37376254 CAGATTTAGGAGACAGTCGCAGG - Intergenic
1107591830 13:41916001-41916023 CAGATTCAAGACAGATTGGCTGG + Intronic
1108288701 13:48935544-48935566 CAGAATGATGACAGGGTGGCAGG - Intergenic
1108322475 13:49302065-49302087 CAGAATGAGGGCAGAGTGGCAGG + Intergenic
1108984868 13:56574058-56574080 AAGAAACAAGAGAGAGTGGCAGG - Intergenic
1111634135 13:90881561-90881583 CAGGAGCAAGAGAGAGTGACGGG - Intergenic
1112261798 13:97884256-97884278 CAGACTCAGGGGAAAGTGGCTGG + Intergenic
1112688485 13:101861341-101861363 CAGAAGCAGGACAGGGTGGGTGG - Intronic
1113115070 13:106866717-106866739 AAGAATGAGAAGAAAGTGGCCGG + Intergenic
1113224032 13:108139883-108139905 CAGAATGAAGAGTGAGTGGAGGG + Intergenic
1113567008 13:111325262-111325284 CAGAGTCATGACAGCGTGGCTGG - Intronic
1113736059 13:112679832-112679854 CAGAATCTGTATAAAGTGGCCGG - Intronic
1114248716 14:20938455-20938477 CAGAAGCAAGAGAGAGAGGGAGG - Intergenic
1114553448 14:23547669-23547691 CAGAAACCGGAGGGAATGGCTGG - Intronic
1115292792 14:31791610-31791632 GAGGAGCAGGAGAGAGTGGCTGG + Intronic
1116214054 14:41987810-41987832 CAGAAATAGAAGAGAGTGGTGGG - Intergenic
1116280964 14:42907010-42907032 TGGAAGGAGGAGAGAGTGGCCGG + Intergenic
1117964134 14:61189524-61189546 CAGAAGCAAGAGAGAGAGGAAGG - Intronic
1118236405 14:64008928-64008950 CAGAATCAGGGGAAACTGCCAGG - Intronic
1119188777 14:72664256-72664278 CAGACTCACTACAGAGTGGCAGG - Intronic
1120383027 14:83807325-83807347 CAGAATTATGAGAGAGTGAGTGG + Intergenic
1121552791 14:94814983-94815005 CAGAACCTGGAGAGAGAGACAGG - Intergenic
1121713656 14:96057500-96057522 CAGCATCAGAACAGAGTGACAGG - Intronic
1121799663 14:96764054-96764076 CAGAAGGAGGAAGGAGTGGCAGG + Intergenic
1122269205 14:100560823-100560845 CAGCAGCAGGACAGAGTTGCAGG - Intronic
1123477562 15:20600829-20600851 CAGAAGCAGGAGAGAGCATCAGG - Intergenic
1123640454 15:22399553-22399575 CAGAAGCAGGAGAGAGCATCAGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1123982778 15:25619246-25619268 GAGAAGCAGGAGAGACGGGCTGG - Intergenic
1124066124 15:26345803-26345825 CATCATCAGGAGACACTGGCTGG + Intergenic
1124959322 15:34382969-34382991 AAGGAGCTGGAGAGAGTGGCAGG - Exonic
1124975948 15:34529190-34529212 AAGGAGCTGGAGAGAGTGGCAGG - Exonic
1126347155 15:47708332-47708354 CAGAATCAGGGGAGGGTGATAGG - Intronic
1126718131 15:51544323-51544345 CAGGAACAAGAGAGAGTTGCGGG - Intronic
1126907465 15:53383525-53383547 CAGAAGCAAGAGAGAGAGGAGGG + Intergenic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1127371762 15:58348135-58348157 CTGAATCTGGAGAGTGTGGAAGG - Intronic
1127996851 15:64158063-64158085 CTGTATCTTGAGAGAGTGGCTGG - Intronic
1128130911 15:65226499-65226521 CAGGATCTGGGGAGAGTGGTTGG - Intergenic
1128237639 15:66078764-66078786 CAAAAGCAGAATAGAGTGGCGGG - Intronic
1129093762 15:73181608-73181630 CAGGATCAGGAGAGTGAGGTGGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129927256 15:79375613-79375635 CAGAAGCAAGAGAGAGAGGGAGG + Intronic
1130000573 15:80043201-80043223 TAGAACCTGGAAAGAGTGGCTGG + Intergenic
1130200938 15:81826285-81826307 CAGAATGAGGAGAGGTTGACTGG + Intergenic
1130898957 15:88192707-88192729 CAGAAGCAGGACAGTGTGACTGG - Intronic
1131191247 15:90318678-90318700 AAGAATCTGGAGAGACAGGCTGG - Intergenic
1131195241 15:90350148-90350170 CAGAAGCTGCAGAGAGCGGCAGG + Intergenic
1132166109 15:99592680-99592702 GAGAAGCAGGAGAGAGTGGGTGG + Intronic
1133483095 16:6190983-6191005 CAGAATCGGGAGAGGCTGGGAGG - Intronic
1135676695 16:24421185-24421207 CAGAAGCAAGAGAGCGAGGCTGG - Intergenic
1135873144 16:26170609-26170631 CAGAAGCAAGAGAGAGTGCAAGG - Intergenic
1136220640 16:28825533-28825555 CAGAATGAGTAGAGTGCGGCGGG + Intronic
1136361339 16:29781898-29781920 GAGAATCAGCAGACAATGGCAGG + Exonic
1136529693 16:30859759-30859781 CAGAATCAGCAAAGGGTGGTGGG - Intronic
1137246163 16:46707069-46707091 CAGAATTAGGAGAGAGGTGGAGG + Exonic
1139084084 16:63562757-63562779 CAGGAGCAAGAGAGAGTGGGAGG - Intergenic
1139542150 16:67626141-67626163 AAGAATCAGGAGAAATGGGCTGG + Intronic
1140248980 16:73277891-73277913 CAGGAGCAAGAGAGAGAGGCAGG + Intergenic
1140664071 16:77212685-77212707 CCGAGTCAGGAGAGAGCGGGCGG + Intronic
1140978675 16:80085069-80085091 CAGAATCTAAAGAGAGTGGTAGG - Intergenic
1141224264 16:82100439-82100461 CAGGAGGAAGAGAGAGTGGCGGG + Intergenic
1141369027 16:83470350-83470372 AAGAAGCAGCAGAGATTGGCTGG - Intronic
1142572845 17:886417-886439 AAGAATCATGAGCAAGTGGCAGG - Intronic
1142684193 17:1568157-1568179 CACAATGATGAAAGAGTGGCCGG - Intergenic
1142806955 17:2376342-2376364 CAGGAGCAGGAGAGAGGAGCAGG - Intronic
1143282110 17:5762675-5762697 CACAATGAGGAGAGAGTGGGAGG - Intergenic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144220383 17:13094630-13094652 CAGTATCAGGAAAGTGGGGCAGG - Intergenic
1144285806 17:13772733-13772755 CACAATCATTAGAGACTGGCTGG + Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1145104306 17:20102538-20102560 CAGAGTCAGCTGAGTGTGGCTGG + Intronic
1147600061 17:41739787-41739809 CAGAGTCGGGAGAGAATGCCAGG - Intergenic
1148110625 17:45143225-45143247 CAGTATCAAGAGAGGCTGGCGGG - Intronic
1148464161 17:47854959-47854981 AAGAATCAGGAGAGTATGGTGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148936729 17:51169144-51169166 GAATATGAGGAGAGAGTGGCTGG + Intronic
1149176345 17:53876402-53876424 CAGAATCAAAAGAAAGTGGTTGG - Intergenic
1149570181 17:57666795-57666817 CAGCAACATGAGAGGGTGGCTGG + Intronic
1151479286 17:74360937-74360959 CAGTAGCAGGAGAGAGGGGCGGG + Intronic
1153573225 18:6494706-6494728 AAGAATCATGGGAAAGTGGCCGG - Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1154283703 18:13031971-13031993 CAGGATAAAGGGAGAGTGGCCGG + Intronic
1155269818 18:24129475-24129497 AAGAATCAGGGTACAGTGGCCGG + Intronic
1156184424 18:34645173-34645195 CAGAATCAGAATAGACAGGCTGG - Intronic
1156966060 18:43093979-43094001 CAGAATTTGGAGAGAGGAGCAGG + Intronic
1157048363 18:44130390-44130412 CTGAATCAGGAAACAGTGGGGGG + Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157564628 18:48671446-48671468 AAGAATCAGGAGAGAAGGGAAGG - Intronic
1157976791 18:52337221-52337243 CAGAAACAGGAGAGAAATGCGGG - Intergenic
1160100276 18:75914485-75914507 CAGAATGAGGAGAGAGGCACAGG - Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160843831 19:1158031-1158053 CGGACTCAGGAGAGAGAGACGGG - Intronic
1161397066 19:4050355-4050377 CAGAAACAAGAGAGACCGGCCGG - Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161710465 19:5844642-5844664 CAGGATCAGGAGGGTGGGGCGGG + Exonic
1162264080 19:9555922-9555944 CAGGAGCAGGAGAGAGGGGGAGG + Intergenic
1162367003 19:10255772-10255794 GAGAATCAGGAAAGAGGAGCAGG - Intronic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1165079391 19:33298818-33298840 CAGACACAGGACAGAGTGGGGGG + Intergenic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166732063 19:45064622-45064644 CAGAAGCAGGTGTGTGTGGCTGG + Exonic
1166864864 19:45829691-45829713 CAGAATCAGGACAGAGAACCAGG + Intronic
1166914197 19:46183467-46183489 AGGAATCAGGAGAGACTGGGAGG - Intergenic
1168650894 19:58091492-58091514 CAGAACCAGGCGGGAGGGGCAGG + Intronic
925067212 2:937793-937815 CTGAGTCAGGAGAGAGTCACGGG + Intergenic
926221810 2:10941349-10941371 CAGCAGCAGGAGAGACGGGCAGG + Intergenic
926287430 2:11500885-11500907 CAGAAAGTGGAGAGAGTGACAGG + Intergenic
926476671 2:13330539-13330561 CTGAATCAGGTCAGAGTGGCTGG - Intergenic
926630740 2:15134014-15134036 CATAGTAAGGAGAGAGTAGCAGG - Intergenic
926828963 2:16939181-16939203 CAGAATAAGGTCACAGTGGCAGG + Intergenic
927136635 2:20101643-20101665 CTGAATCAGGAGACAGTAACGGG - Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927875141 2:26650240-26650262 AAGAGTCAGGAGAGACTGGGAGG + Intergenic
928135186 2:28682599-28682621 CAGACTCAGGAGAGATAGACAGG - Intergenic
929043849 2:37772112-37772134 CAGCTTCAGGACAGAGAGGCTGG - Intergenic
929427346 2:41856684-41856706 CAGACGCAGTAGAGAGAGGCAGG - Intergenic
929440873 2:41965123-41965145 CAGAGTCAGGATAGAGGGTCTGG - Intergenic
929777484 2:44938105-44938127 CAAAACAAGGAGAGAGTGGGAGG + Intergenic
929785549 2:44988264-44988286 CAGGATCAGGAGTGAGGGGTGGG + Intergenic
930242347 2:48949029-48949051 CAGAATCAGGCAGAAGTGGCAGG + Intergenic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
931383263 2:61773490-61773512 CAGGAACAAGAGGGAGTGGCAGG + Intergenic
931460824 2:62448703-62448725 CATAAACAGGAGAGAGTGCTGGG + Intergenic
932078884 2:68693064-68693086 CAGATTCAGGAGCCATTGGCGGG + Intronic
933769507 2:85734175-85734197 CAGAATCATGAGACAGGAGCTGG + Intergenic
935044567 2:99468672-99468694 CTGGATAAGGAGAGATTGGCAGG - Intronic
935213172 2:100955690-100955712 CTGAAGCAGCAGTGAGTGGCTGG + Intronic
935292864 2:101624831-101624853 CGGAATCTGGAGGGAGGGGCGGG - Intergenic
935536427 2:104299936-104299958 CAGAAGCAAGAGAGAGTGAAGGG + Intergenic
935675153 2:105588872-105588894 CAGAATTCAGTGAGAGTGGCAGG - Intergenic
936938886 2:117862714-117862736 CAAAATCATGAGAGACTGCCTGG - Intergenic
938625731 2:133106892-133106914 CAGAATCAAAAGTGAATGGCTGG + Intronic
938803713 2:134786969-134786991 CAGAAGCAGGAGAAAGTTGAAGG + Intergenic
938827754 2:135023264-135023286 GAGAATCAGAAGAGAGTTGCGGG - Intronic
939779729 2:146430914-146430936 CAGGAGCAAGAGAGAGTGGGGGG - Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
941751325 2:169137847-169137869 AAGAATAAGGAGAGAGGGGAAGG + Intronic
941932516 2:170956273-170956295 CAAAATTAGGAGGGAGTGTCTGG + Intronic
942121601 2:172783223-172783245 CAGAGTGAGGACAGAGTGGTCGG + Intronic
942295403 2:174511952-174511974 CAGACTCAGGAAAGAGCAGCAGG - Intergenic
942428127 2:175880692-175880714 CTGAATCAGGGGAGAGTGATGGG + Intergenic
942648641 2:178143735-178143757 CTGATGCAGGAGATAGTGGCAGG + Intergenic
944143559 2:196482423-196482445 CTGAATCAGGAATGAGTGGGAGG + Intronic
944896016 2:204165645-204165667 TAGAATCAGGAGAGTGGGCCTGG + Intergenic
945049404 2:205808807-205808829 CACAATCAGCAGGGAGGGGCAGG + Intergenic
947591788 2:231390041-231390063 GAGAATCAGGTGAGAGGTGCTGG - Intergenic
947895187 2:233664600-233664622 CAGGATCAAGAGAGAGTTGGTGG + Intronic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948197726 2:236107721-236107743 CAGAATCAGGAAAACCTGGCTGG + Intronic
948282958 2:236762577-236762599 CAGGATCCAGAGAGAGAGGCCGG + Intergenic
1169192554 20:3667389-3667411 CAGAATCAGGAGCGAGTGGAAGG - Intergenic
1170105808 20:12753553-12753575 GAGAAACAGGAGGCAGTGGCAGG - Intergenic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170530024 20:17281818-17281840 GAGAATCAGGTGAGAGTGGCAGG - Intronic
1171259339 20:23718039-23718061 AAGATTCAGGGGAGTGTGGCAGG - Intergenic
1171302440 20:24075500-24075522 CAAAAGCAGGAGTAAGTGGCAGG + Intergenic
1172726279 20:37044633-37044655 CAGAATAAGGCCACAGTGGCCGG - Intronic
1172874335 20:38155160-38155182 CAGAACCAGGACACAGTGCCTGG + Intronic
1173352487 20:42257658-42257680 CAGGATCAAGAGAGAGTAGTGGG - Intronic
1173465924 20:43281398-43281420 GACACTCAGGGGAGAGTGGCAGG - Intergenic
1175087686 20:56473936-56473958 GAGGAACAGGAGAGAATGGCAGG + Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1180211818 21:46299442-46299464 CAGAATCAGGGCAGTATGGCTGG - Intergenic
1180902763 22:19386597-19386619 TAGACTCAGGAGAGAAGGGCAGG - Intronic
1180947622 22:19705385-19705407 CAGAAGCAGGGAAGAGGGGCTGG - Intergenic
1182001853 22:26926363-26926385 CAGAAAGAGGAGAGAATGGGAGG - Intergenic
1182066714 22:27436284-27436306 CAGAATCTGGAGACAATGGAAGG + Intergenic
1182163152 22:28144065-28144087 CAGGCTCAGGAAATAGTGGCTGG - Intronic
1182871863 22:33654602-33654624 CACAAGCAGGAGAGAGGGTCAGG + Intronic
1183309395 22:37101282-37101304 CTGAAGCAGGAGACAGGGGCAGG + Intronic
1183346736 22:37312271-37312293 CAGAAACAGGAGGGAGAGACTGG - Intronic
1183659704 22:39211990-39212012 CAGAAGCACGAGAGAGTGGGGGG - Intergenic
1184144794 22:42603363-42603385 CAAAATTAAGAGAGAGGGGCTGG + Intronic
1184441563 22:44519817-44519839 TAGAAGCAGGGGAGAGGGGCTGG - Intergenic
1185028613 22:48429838-48429860 CAGAATCAGGAGAGTCCAGCTGG + Intergenic
1185236060 22:49713725-49713747 GAGGAGCAGGAGAGCGTGGCCGG + Intergenic
1185385736 22:50530663-50530685 CAGAGTCAGGAGAGTGGGGAGGG - Intronic
949465460 3:4339090-4339112 CAGAATGAGGAGGGAGTAGTGGG - Intronic
949891107 3:8734287-8734309 GAGAGCCAGGAGTGAGTGGCAGG - Intronic
949980656 3:9500184-9500206 CAGAGTTAGGAGAGAGTGAGGGG - Exonic
950705987 3:14782118-14782140 CAGGAGCAAGAGAGAGTGGGTGG - Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
953125955 3:40092103-40092125 CAGAATGAGCACAGACTGGCAGG - Intronic
953626923 3:44579350-44579372 CTGAATCAGGAGCGGGTGGGCGG - Intronic
954150909 3:48656553-48656575 CAGAAGCCGTAGAGCGTGGCCGG - Intronic
954745202 3:52783871-52783893 TAGAAAGAGGGGAGAGTGGCAGG + Intronic
955358349 3:58250556-58250578 CAGAAACAGGAGGGAGAGGAAGG + Intronic
955403341 3:58609188-58609210 CACAGCCAGAAGAGAGTGGCTGG - Intronic
955413718 3:58673069-58673091 CAGACTGTGGACAGAGTGGCTGG - Intergenic
955744386 3:62125600-62125622 CAGAATCAGGAGAAACTTGTAGG + Intronic
956460925 3:69471761-69471783 CTGAGTCAGAAGAGAGTGGATGG - Intronic
956489378 3:69754462-69754484 CAGGAGCAAGAGAGAGTGACAGG - Intronic
956775098 3:72558446-72558468 CAGGAGCAAGAGAGAGAGGCAGG - Intergenic
959531630 3:107440298-107440320 CAGAGTGAGGCCAGAGTGGCTGG + Intergenic
960708224 3:120502183-120502205 CAGAATCAGGTGGCGGTGGCTGG - Intergenic
960724865 3:120659927-120659949 CAGGAGCAAGAGAGAGTGGGGGG + Intronic
961764736 3:129200556-129200578 CAGAATCACCAGCAAGTGGCCGG - Intergenic
961765524 3:129207552-129207574 CAGCCTCTGGAGACAGTGGCTGG - Intergenic
964555707 3:157935979-157936001 GAGACTCTGGAGAGACTGGCTGG - Intergenic
965072175 3:163928122-163928144 GAGAATCAAGAAAGAATGGCTGG + Intergenic
966205125 3:177398319-177398341 CAGAAGCAGGAGAGAGGGGAGGG + Intergenic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967550739 3:190792386-190792408 GAGAAGCAGGAGAGAGAGGAAGG + Intergenic
967860628 3:194148715-194148737 CAGAAACCAGAGAGCGTGGCAGG - Intergenic
967951845 3:194847397-194847419 CTGTACCAGGAGAGAGTGGCTGG + Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968384491 4:124339-124361 CTGAATGAGGCGAGAGTGACAGG - Intergenic
968617120 4:1582447-1582469 CAGACCCAAGAGAGAGTGGACGG + Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
970511338 4:16784748-16784770 CGGAAGAAGGAGAGAGTGGTGGG - Intronic
970971914 4:21994733-21994755 GAGAAACAAGAGAGAGTGGCAGG + Intergenic
971292866 4:25360499-25360521 CAGATTCATGAGAGCATGGCAGG + Intronic
972149390 4:36069933-36069955 CAGAAGCAAGAGAGAGAGGGGGG - Intronic
972413547 4:38816523-38816545 CAGAAGCAAGAGAGAGTGTGGGG + Intronic
972612999 4:40672403-40672425 CAGGATAAGGAGACAGTGACGGG + Intergenic
975210005 4:71688983-71689005 CAGAATGAGGAGAGACTGAAAGG - Intergenic
976633486 4:87263947-87263969 CAGTATCAGGAGGCAGAGGCAGG - Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
977118727 4:93069001-93069023 CAGAAACAAGAGAGAGAGGAGGG + Intronic
977769981 4:100846633-100846655 CACACTCAGAAGAGAGTAGCAGG + Intronic
977895657 4:102361839-102361861 CAGAATGAGGAGAGTGTGTTAGG - Intronic
978353910 4:107850122-107850144 CAGGATCAAGAGACAGTGGGAGG - Intronic
979275550 4:118811120-118811142 TAGGATCAGGAGAGAGTGGGAGG + Intronic
979875979 4:125891811-125891833 CAGATTCAGGAGACATTAGCAGG - Intergenic
980113233 4:128654494-128654516 CAGAATGGGGAGTGAGTTGCTGG - Intergenic
980970249 4:139560569-139560591 CAGAAGCTGGAGGGAGGGGCTGG + Intronic
981135543 4:141207013-141207035 CAGAAGAAGGTGAGACTGGCTGG - Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
982464547 4:155713822-155713844 AAGAATGAGGAGAGAATGGAGGG + Intronic
983010690 4:162542422-162542444 CAGGATCAGGAGAGAATTGAAGG - Intergenic
983594042 4:169446065-169446087 CAGAAGCTGGAAAGTGTGGCTGG + Intronic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
983929853 4:173441455-173441477 TAGAATCAGGACAGAGGGGGTGG - Intergenic
984398992 4:179237728-179237750 CTGAATCAAGAGATAGTGACAGG + Intergenic
985583066 5:710134-710156 CAGGAGCAAGAGAGAGTGGTGGG - Intergenic
985596745 5:795386-795408 CAGGAGCAAGAGAGAGTGGTGGG - Intergenic
986024038 5:3833291-3833313 CAGAAGCAAGAGAGAGCGGGTGG - Intergenic
986050394 5:4084548-4084570 CAAAATCAGGAGGGAGAAGCTGG - Intergenic
986071916 5:4293829-4293851 CAGAATCATGATAGAGGAGCAGG + Intergenic
986305417 5:6510679-6510701 CAGGATCAAGAGAGAGTTGGGGG + Intergenic
986410351 5:7473355-7473377 GAGAAGCAAGAGAGAGTGGGGGG + Intronic
988081870 5:26425622-26425644 GAGGATTAAGAGAGAGTGGCCGG - Intergenic
988466592 5:31497663-31497685 GAGAATCATGAGAGAGTGAATGG - Intronic
988889395 5:35598627-35598649 CAGAATCAGGGAGGAGTCGCAGG + Intergenic
989161740 5:38397849-38397871 CAGAAGCAGGTGAGAGAGGAGGG + Intronic
989189557 5:38657152-38657174 GAGAGTGAGGAGGGAGTGGCAGG - Intergenic
990264246 5:54058661-54058683 CAGAAGCGGGACAGTGTGGCTGG + Intronic
990319159 5:54612791-54612813 CTGACTCAGGAGACAGTGACAGG + Intergenic
990373543 5:55145845-55145867 CAGAAGCAGGAGAGAATGAGAGG - Intronic
991331706 5:65499602-65499624 CAGAAAGAGGAGAAAGTGGGTGG - Intergenic
992461133 5:76961335-76961357 CAGACTCAGGAGAGAGAAGTAGG - Intronic
992533112 5:77671402-77671424 CAGAATCTGGAGGGGGTGGAGGG + Intergenic
993142035 5:84046259-84046281 CAGAATCTGCAGAGCCTGGCTGG + Intronic
993323046 5:86498751-86498773 CAGAATCTGGAGACTATGGCAGG - Intergenic
995533953 5:113117180-113117202 CAGAGTGAGGAGAGAGGGTCGGG - Intronic
995826189 5:116302256-116302278 CAGCATCAGGAGTGAATGGCAGG + Intronic
996216255 5:120870185-120870207 CAGAATCAGGAAAGAATGGCTGG - Intergenic
997206082 5:132051006-132051028 CAGGGTCAGGAGTGAGTGGCAGG - Intergenic
997363586 5:133311280-133311302 CATAATAAGGTGAGAGTGACTGG - Intronic
998699565 5:144682828-144682850 GAGAGTCAGGAAAGAGTGGGAGG - Intergenic
999862641 5:155665122-155665144 CATAAGTAGGATAGAGTGGCTGG + Intergenic
1000228152 5:159289852-159289874 CAGATTCAGGTAAGAGTGGGAGG + Intergenic
1000257700 5:159556420-159556442 CAGATTCTGGAGGCAGTGGCTGG + Intergenic
1001180318 5:169514096-169514118 CAGAATAAGTTGGGAGTGGCTGG + Intergenic
1001478028 5:172064819-172064841 CAGAGACAGCAGAGAGTAGCTGG + Intronic
1002306686 5:178287684-178287706 CAGCAGCAGAAGAGATTGGCAGG - Intronic
1002392655 5:178927992-178928014 CAGGAGCAAGAGAGAGTGGCAGG + Intronic
1002777888 6:344052-344074 CAGAATGAGGTCTGAGTGGCAGG + Intronic
1002922866 6:1585575-1585597 CAGAATGTGGGGAGAGTGGGGGG - Intergenic
1003184613 6:3820264-3820286 CAGACTCAGGAGAGCATGGGAGG + Intergenic
1003405584 6:5824593-5824615 CAGCATCTGGAGAGGATGGCTGG - Intergenic
1003464377 6:6364399-6364421 TAGAATCAGCACAGACTGGCTGG + Intergenic
1003510157 6:6772939-6772961 CAGGATCGGGAGAGAGAAGCCGG + Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1004141129 6:13018688-13018710 CAGACTGAGGACAGAGTGGTAGG + Intronic
1005056942 6:21738290-21738312 AAGTATCAGTAGAGAGTGGTAGG + Intergenic
1005085078 6:21997775-21997797 CTGAAGCAGGAGCGAGTGGGTGG + Intergenic
1006116964 6:31780659-31780681 CAGAAGGAGGAAGGAGTGGCTGG + Intronic
1006536409 6:34702594-34702616 AAGAATCATGAGACAGAGGCCGG + Intergenic
1007091676 6:39188718-39188740 GAGAATCAGGAAGGAGTGGGAGG - Intergenic
1007234732 6:40382389-40382411 CAGAATCAGAAGAGTCTGGTTGG - Intergenic
1007354117 6:41298150-41298172 CAGAAGCAAGAGAGAATGGTGGG - Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007815114 6:44516779-44516801 CAGAGACTGGAAAGAGTGGCAGG - Intergenic
1007880549 6:45161045-45161067 CAGAAGCAAGAGAGAGTGTTGGG - Intronic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1010760711 6:79719119-79719141 CAGAAACAGCATAGAGTGCCAGG + Intergenic
1013124833 6:107172827-107172849 CAGAAATAGGATAGAGTGGCTGG + Intronic
1013566634 6:111371100-111371122 CAGAAGCAGAAGAGGATGGCTGG - Intronic
1017629546 6:156383081-156383103 CAGGAACAAGAGAGAGTGGCGGG - Intergenic
1018297815 6:162368002-162368024 CAGAAGCAGGAGAGAGGGAAGGG + Intronic
1018795274 6:167180300-167180322 CAGACACAGGAGAGAAAGGCCGG - Intronic
1018971904 6:168535978-168536000 CAGAATCCAGAGAGAACGGCCGG - Intronic
1020144446 7:5631982-5632004 CAGAAGATGCAGAGAGTGGCTGG + Intronic
1020414417 7:7929605-7929627 CAGAAGGAGGAGTGAGTGGCTGG + Intronic
1022155304 7:27654981-27655003 CACAGTCAAGAGAGTGTGGCTGG - Intronic
1023103230 7:36739847-36739869 AAGGACCAGGAGAGATTGGCAGG - Intergenic
1024673851 7:51620762-51620784 CAGGATGAGGGGAGAGTGCCTGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025171671 7:56763832-56763854 AAGAATCATGAGAGAGAGGGAGG + Intergenic
1025724590 7:64045288-64045310 CTGAATGAGGAAAGAGTGACAGG - Intronic
1026876452 7:73881737-73881759 CAGAATCAGGGGAGGGGGGTGGG + Intergenic
1027784686 7:82566105-82566127 AAGAAAGAGGAGAAAGTGGCCGG - Intergenic
1029419199 7:100463709-100463731 GAGAGACAGGAGAGAGGGGCAGG + Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1033545119 7:142392535-142392557 CAGAAGCACCAGAGAGTGCCTGG - Intergenic
1033548177 7:142421260-142421282 AAGAAGCAGCAGAGAGTGCCTGG - Intergenic
1034002315 7:147428928-147428950 GAGAATCGGGAAAGAGTGGGAGG - Intronic
1035476744 7:159149268-159149290 CAGAAGCAGAAGGGAGAGGCTGG - Intergenic
1036293842 8:7518797-7518819 GAGAATCAGGAGAGAGGTGGAGG + Intergenic
1036328719 8:7802198-7802220 GAGAATCAGGAGAGAGGTGGAGG - Intergenic
1036757499 8:11480995-11481017 CAGGAGCAGGAGGGTGTGGCTGG - Intergenic
1037081777 8:14796631-14796653 CAAAATAAGTAGAGAGTGTCAGG - Intronic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1043155184 8:76769960-76769982 CAGTAGCAGGAGACAGTAGCAGG - Intronic
1043788727 8:84435730-84435752 AAGATTCAGGAAAGAGAGGCTGG - Intronic
1044407821 8:91850158-91850180 CAGAATCTGGAAAGGGTGGTTGG + Intergenic
1045557797 8:103231513-103231535 CAGAATGAGGAGGTAATGGCTGG + Intergenic
1046295733 8:112217402-112217424 CAGTATCAAGAGACAGTGGGGGG + Intergenic
1046813705 8:118560453-118560475 AAGAGTCAGGAGACAGTGGATGG + Intronic
1047306164 8:123654714-123654736 CAGAATCACGAGAGAGAGTGAGG + Intergenic
1047407229 8:124595786-124595808 GTGAATCTGGAGAGTGTGGCAGG + Intronic
1047504500 8:125468502-125468524 TAAAATCAGGAGAGTGTAGCAGG + Intergenic
1047711117 8:127553440-127553462 CAGTAGCAAGAGAGAGAGGCAGG - Intergenic
1048146927 8:131854164-131854186 CAGAAGCAAGAGAGAGAGGGTGG - Intergenic
1049257791 8:141623165-141623187 CAGAGTCAGGTGAGTGGGGCAGG - Intergenic
1049494274 8:142922459-142922481 CAGCATCAGCAGGGAGGGGCAGG - Intergenic
1049550941 8:143259349-143259371 CACACTCAGGAGAGACGGGCCGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1051621175 9:19050551-19050573 GAGAAGCTGGAGAGAGTGGATGG + Exonic
1052544839 9:29863573-29863595 CAAACTCAGCAGAGATTGGCAGG - Intergenic
1052772771 9:32704756-32704778 CAGATTCAGGAGACAGGGGTGGG - Intergenic
1052838047 9:33265802-33265824 CAGAATCGGGGCAGTGTGGCGGG + Intronic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056570135 9:87807699-87807721 GAGAAGCAGCAGAGATTGGCTGG + Intergenic
1057310271 9:93938592-93938614 CAGAAGCAGTAGAGAGGGGAGGG + Intergenic
1057801789 9:98195501-98195523 AAGAATGAGGAGACAGTGCCTGG + Intergenic
1057897977 9:98924805-98924827 GAGCATCAGGAGAGGGTGCCAGG + Intergenic
1058095375 9:100854331-100854353 TTTAATCAGGAGAGAGTGACAGG + Intergenic
1058729489 9:107836241-107836263 CAGTGCCAGGAGAGTGTGGCTGG - Intergenic
1060521135 9:124294774-124294796 GAGTTTCAGGAGAGATTGGCAGG + Intronic
1060773127 9:126347136-126347158 TAGATACAGGAGAGAGGGGCTGG + Intronic
1061357368 9:130116603-130116625 GAGAAACAGGAGAGACTGACGGG + Intronic
1061576812 9:131512528-131512550 CACCATCAGGAGACAGTGACCGG - Intronic
1062084954 9:134643634-134643656 CAGGGTCAGGAGAGAGTTGGTGG - Intronic
1062584811 9:137244464-137244486 AAGACTCAGGAGAGAGGGGTTGG + Intronic
1186855171 X:13619460-13619482 CAGCATCAGGTGGGAGTGGCGGG - Intronic
1187277440 X:17828321-17828343 AGGAATCAGGAGAGAGAGGGAGG - Intronic
1187686403 X:21819832-21819854 CAGGACCAAGAGAGAGTGACAGG - Intergenic
1189512558 X:41677613-41677635 CAGGTTCAGGAGAGAATGGGAGG + Intronic
1191700066 X:64032925-64032947 CAGAACCAGGAGAGACTGCATGG + Intergenic
1193206906 X:78759970-78759992 CAGAATCAGGAGACATTTGAGGG - Intergenic
1193238883 X:79143026-79143048 CAGAATCAGAAGACAATGCCAGG + Intergenic
1194347823 X:92787395-92787417 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1195991254 X:110684526-110684548 CAGGATCAAGAGAGAGTGAATGG - Intronic
1196318588 X:114260742-114260764 CAGAAGATGGAGAGAGTGGATGG - Intergenic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1197829902 X:130630405-130630427 TAGAGGGAGGAGAGAGTGGCTGG + Intronic
1197996370 X:132379738-132379760 AAGAGTCAGGAGAGTGTGGTGGG + Intronic
1198003213 X:132462223-132462245 GAGAAACAGGAGAGAGAGGGAGG - Intronic
1198388336 X:136148333-136148355 CAGAATAAGGAGGGAGGGGGAGG + Intronic
1199423769 X:147677127-147677149 CAGAAACGGGAGAGAGTGGAAGG - Intergenic
1200122717 X:153798687-153798709 CAGAACCAGGAGAGAGTCACTGG - Intergenic
1200656151 Y:5904031-5904053 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic